2024-04-23 22:05:06, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_057109 2392 bp mRNA linear ROD 21-MAR-2023 DEFINITION Rattus norvegicus BarH-like homeobox 1 (Barhl1), mRNA. ACCESSION NM_057109 VERSION NM_057109.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 2392) AUTHORS Barh D, Garcia-Solano ME, Tiwari S, Bhattacharya A, Jain N, Torres-Moreno D, Ferri B, Silva A, Azevedo V, Ghosh P, Blum K, Conesa-Zamora P and Perry G. TITLE BARHL1 Is Downregulated in Alzheimer's Disease and May Regulate Cognitive Functions through ESR1 and Multiple Pathways JOURNAL Genes (Basel) 8 (10), 245 (2017) PUBMED 28956815 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 2392) AUTHORS Chellappa R, Li S, Pauley S, Jahan I, Jin K and Xiang M. TITLE Barhl1 regulatory sequences required for cell-specific gene expression and autoregulation in the inner ear and central nervous system JOURNAL Mol Cell Biol 28 (6), 1905-1914 (2008) PUBMED 18212062 REFERENCE 3 (bases 1 to 2392) AUTHORS Li S and Xiang M. TITLE Barhl1 is required for maintenance of a large population of neurons in the zonal layer of the superior colliculus JOURNAL Dev Dyn 235 (8), 2260-2265 (2006) PUBMED 16752387 REFERENCE 4 (bases 1 to 2392) AUTHORS Li S, Qiu F, Xu A, Price SM and Xiang M. TITLE Barhl1 regulates migration and survival of cerebellar granule cells by controlling expression of the neurotrophin-3 gene JOURNAL J Neurosci 24 (12), 3104-3114 (2004) PUBMED 15044550 REFERENCE 5 (bases 1 to 2392) AUTHORS Li S, Price SM, Cahill H, Ryugo DK, Shen MM and Xiang M. TITLE Hearing loss caused by progressive degeneration of cochlear hair cells in mice deficient for the Barhl1 homeobox gene JOURNAL Development 129 (14), 3523-3532 (2002) PUBMED 12091321 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from JACYVU010000115.1. On Nov 27, 2020 this sequence version replaced NM_057109.1. ##Evidence-Data-START## Transcript exon combination :: AB043981.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA5760393, SAMEA5760433 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1226 JACYVU010000115.1 5704245-5705470 c 1227-1449 JACYVU010000115.1 5700520-5700742 c 1450-2392 JACYVU010000115.1 5698148-5699090 c FEATURES Location/Qualifiers source 1..2392 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="3" /map="3p12" gene 1..2392 /gene="Barhl1" /gene_synonym="Barhl2; Mbh2" /note="BarH-like homeobox 1" /db_xref="GeneID:117232" /db_xref="RGD:620648" exon 1..1226 /gene="Barhl1" /gene_synonym="Barhl2; Mbh2" /inference="alignment:Splign:2.1.0" misc_feature 686..688 /gene="Barhl1" /gene_synonym="Barhl2; Mbh2" /note="upstream in-frame stop codon" CDS 761..1744 /gene="Barhl1" /gene_synonym="Barhl2; Mbh2" /note="barH-related homeobox protein 1; bar-class homeodomain protein MBH2; BarH-like 2" /codon_start=1 /product="barH-like 1 homeobox protein" /protein_id="NP_476450.1" /db_xref="GeneID:117232" /db_xref="RGD:620648" /translation="
MEGSNGFGIDSILSHRAGSPALPKGDPLLGDCRSPLELSPRSESSSDCSSPASPGRDCLETSTSRPGAASGPGLDSHLQPGQLSAPAQSRTVTSSFLIRDILADCKPLAACAPYSSSGQPAAPEPGGRLAAKAGEDFRDKLDKSVSSASSDSEYKVKEEGDREISSSRDSPPVRLKKPRKARTAFTDHQLAQLERSFERQKYLSVQDRMELAASLNLTDTQVKTWYQNRRTKWKRQTAVGLELLAEAGNYSALQRMFPSPYFYPQSLVSNLDPGAALYLYRGPSAPPPALQRPLVPRILIHGLQGASEPPPPLPPLPGVLPRAAQPR"
misc_feature 761..1030 /gene="Barhl1" /gene_synonym="Barhl2; Mbh2" /note="propagated from UniProtKB/Swiss-Prot (P63156.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 1097..1303 /gene="Barhl1" /gene_synonym="Barhl2; Mbh2" /note="propagated from UniProtKB/Swiss-Prot (P63156.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature order(1295..1309,1313..1315,1364..1366,1382..1384, 1421..1423,1427..1432,1439..1444,1448..1456,1460..1465) /gene="Barhl1" /gene_synonym="Barhl2; Mbh2" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(1301..1303,1310..1312,1430..1432,1439..1444, 1451..1453) /gene="Barhl1" /gene_synonym="Barhl2; Mbh2" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 1304..1462 /gene="Barhl1" /gene_synonym="Barhl2; Mbh2" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature 1667..1741 /gene="Barhl1" /gene_synonym="Barhl2; Mbh2" /note="propagated from UniProtKB/Swiss-Prot (P63156.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" exon 1227..1449 /gene="Barhl1" /gene_synonym="Barhl2; Mbh2" /inference="alignment:Splign:2.1.0" exon 1450..2392 /gene="Barhl1" /gene_synonym="Barhl2; Mbh2" /inference="alignment:Splign:2.1.0" ORIGIN
gaaacaacaacaaaaaagccagccctaaagtaaaagtgacacaagttctattttttttttaaaggaaggaggggggttggcggcgaaggcgcgcgccgaggacaggtgagagctgcagtgggagcggcagggagctgtccacggtgctgacgggccctggcggggccgagcgtgcacgcaggagctctggggccaggtggggctgcttgatcctggggccgcggccgctgtccgcggtgctgagacctccaggtgcgctccgttctgcctgctggtaacgcggcccgggccggctgctatccgccgtgctgacccctgccctgggctaccgtttgcctggaggaagcgtgccgtttggattttgctttttcaaaagacgatctttattcagattctatcagcctcgcgtttcttcagtgccaaaggggccctcgggccgttcttctaccctttggctcttcccaacttggcgcgccctcctcccattcctccctgacactcccaccaccaccaccccaccccctcggctcggcggctcggcgcggtgctgcagaagacgctttgagcccttttggatgtgatgcgcagaggaggttggcccagagctcccaggctcccccaaggctgaactccatccaaggtgcccacaggctccctgcccgccttccccatgccagcccgcagctaggggcaggggcagcggcggctggggttgggggtgggtggggagcttttggggaggacaggtcgcagcttggctatggaaggctccaatggctttgggattgactccattctctcccaccgagcgggcagccccgcccttcccaagggggaccccttgcttggggactgccgttcacccctggagctgagtccacgctcagagagcagcagcgactgctcttcaccagcctcgcccggaagagactgtctggagaccagtacctcgcggcctggtgcagcatctggcccaggtttggactcccacctgcagccggggcagctttcagccccagcccagtcgcgaactgtcacctcctcctttctgatcagggacatccttgctgactgcaaacctctggcggcctgtgcaccctactctagcagtgggcagcctgcagcccctgagcctgggggccgccttgcggccaaggccggggaggactttcgagacaagctggacaaaagtgtcagcagcgcttcatcggactctgagtacaaagtgaaggaggagggcgaccgcgaaatctccagctctcgggacagtcctcccgtgcgcctgaaaaagccacgcaaagcacgcaccgccttcaccgaccatcagctggcgcagctggagcgtagcttcgagcggcagaaatacctgagtgtgcaagaccgcatggagctggccgcctctctgaacctcaccgacacgcaggtcaagacctggtaccagaaccgcaggactaaatggaagcgacagaccgctgtggggctggagctgctagcggaggcaggcaattattcggcgctccagagaatgttcccgtcgccttatttctacccgcagagtctcgtttccaacctggaccccggcgccgcactctatctgtaccgcggacccagtgcgccaccacctgccctccagagacctctggtgccccgcatcctcatccacggactccagggcgccagcgagccgcccccaccgctgcccccgctgcccggcgtccttccgcgcgctgcgcagccccggtgaagcgcgcgcttgccccaagccatgctctgggacccacagctcagcctgggcgcgggtccctcccttcgtcccggggcagggctgcccggctccccgccgcagcccagtgtccccgtgggaaagaaattcactgaggctacccctcccctgcgtcctctcttggctgctccatccaggaaccactcacacccgccggatgtacatatgcgcccctgcccacctctcagccacccccaggtccctgccggcttccccaggtgtcccctgtcccctcagcagcaggtaggggacgccggtctcccagacctgggcccacccttcttgcgcctctgcgggacagggtgggagcgctgtacggagtttccctcccatttcttttattctccctgagccccgggctagcagcggagctgtacatacagtgtgcaaagtgtatatgaagttatttattcgtgacccatgagcccgtgaccgtgtccgtgaatcagtgagtctgtggcctgtgccctccccatcccgggtggggcaggaaggggccgagagggcttgcccacgcgtcctggcccccagccccgctcgctccacccaggtcccaggacagccagatctcttgggttctctttttttaaatgtggaaataaacttctt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]