LOCUS       NM_053869               1608 bp    mRNA    linear   ROD 21-MAR-2023
DEFINITION  Rattus norvegicus paired-like homeobox 2a (Phox2a), mRNA.
ACCESSION   NM_053869
VERSION     NM_053869.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1608)
  AUTHORS   Fan Y, Huang J, Duffourc M, Kao RL, Ordway GA, Huang R and Zhu MY.
  TITLE     Transcription factor Phox2 upregulates expression of norepinephrine
            transporter and dopamine beta-hydroxylase in adult rat brains
  JOURNAL   Neuroscience 192, 37-53 (2011)
   PUBMED   21763404
  REMARK    GeneRIF: The present study demonstrates an upregulatory effect of
            Phox2a and Phox2b on the expression of dopamine beta-hydroxylase
            and norepinephrine transporter in noradrenergic neurons of rat
            brains
REFERENCE   2  (bases 1 to 1608)
  AUTHORS   Deng Q, Andersson E, Hedlund E, Alekseenko Z, Coppola E, Panman L,
            Millonig JH, Brunet JF, Ericson J and Perlmann T.
  TITLE     Specific and integrated roles of Lmx1a, Lmx1b and Phox2a in ventral
            midbrain development
  JOURNAL   Development 138 (16), 3399-3408 (2011)
   PUBMED   21752929
REFERENCE   3  (bases 1 to 1608)
  AUTHORS   Coppola E, d'Autreaux F, Rijli FM and Brunet JF.
  TITLE     Ongoing roles of Phox2 homeodomain transcription factors during
            neuronal differentiation
  JOURNAL   Development 137 (24), 4211-4220 (2010)
   PUBMED   21068058
REFERENCE   4  (bases 1 to 1608)
  AUTHORS   Card JP, Lois J and Sved AF.
  TITLE     Distribution and phenotype of Phox2a-containing neurons in the
            adult sprague-dawley rat
  JOURNAL   J Comp Neurol 518 (12), 2202-2220 (2010)
   PUBMED   20437524
  REMARK    GeneRIF: mapped the distribution of Phox2a in the adult rat brain;
            data support the conclusion that Phox2a plays an important role in
            brainstem catecholamine neurotransmission and in the regulation of
            adaptive homeostatic functions in the adult nervous system
REFERENCE   5  (bases 1 to 1608)
  AUTHORS   Hasan KB, Agarwala S and Ragsdale CW.
  TITLE     PHOX2A regulation of oculomotor complex nucleogenesis
  JOURNAL   Development 137 (7), 1205-1213 (2010)
   PUBMED   20215354
  REMARK    GeneRIF: Data show that exogenous Phox2a delivery to embryonic
            chick midbrain can drive a complete oculomotor complex molecular
            program, including the production of visceral and somatic
            motoneurons.
REFERENCE   6  (bases 1 to 1608)
  AUTHORS   Qian Y, Shirasawa S, Chen CL, Cheng L and Ma Q.
  TITLE     Proper development of relay somatic sensory neurons and D2/D4
            interneurons requires homeobox genes Rnx/Tlx-3 and Tlx-1
  JOURNAL   Genes Dev 16 (10), 1220-1233 (2002)
   PUBMED   12023301
REFERENCE   7  (bases 1 to 1608)
  AUTHORS   Nakano M, Yamada K, Fain J, Sener EC, Selleck CJ, Awad AH, Zwaan J,
            Mullaney PB, Bosley TM and Engle EC.
  TITLE     Homozygous mutations in ARIX(PHOX2A) result in congenital fibrosis
            of the extraocular muscles type 2
  JOURNAL   Nat Genet 29 (3), 315-320 (2001)
   PUBMED   11600883
REFERENCE   8  (bases 1 to 1608)
  AUTHORS   Pattyn A, Morin X, Cremer H, Goridis C and Brunet JF.
  TITLE     Expression and interactions of the two closely related homeobox
            genes Phox2a and Phox2b during neurogenesis
  JOURNAL   Development 124 (20), 4065-4075 (1997)
   PUBMED   9374403
REFERENCE   9  (bases 1 to 1608)
  AUTHORS   Morin X, Cremer H, Hirsch MR, Kapur RP, Goridis C and Brunet JF.
  TITLE     Defects in sensory and autonomic ganglia and absence of locus
            coeruleus in mice deficient for the homeobox gene Phox2a
  JOURNAL   Neuron 18 (3), 411-423 (1997)
   PUBMED   9115735
REFERENCE   10 (bases 1 to 1608)
  AUTHORS   Zellmer E, Zhang Z, Greco D, Rhodes J, Cassel S and Lewis EJ.
  TITLE     A homeodomain protein selectively expressed in noradrenergic tissue
            regulates transcription of neurotransmitter biosynthetic genes
  JOURNAL   J Neurosci 15 (12), 8109-8120 (1995)
   PUBMED   8613746
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JACYVU010000042.1.
            
            On Nov 27, 2020 this sequence version replaced NM_053869.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: U25967.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMD00132261, SAMD00132262
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-413               JACYVU010000042.1  6641409-6641821
            414-601             JACYVU010000042.1  6643878-6644065
            602-1608            JACYVU010000042.1  6644767-6645773
FEATURES             Location/Qualifiers
     source          1..1608
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="1"
                     /map="1q32"
     gene            1..1608
                     /gene="Phox2a"
                     /gene_synonym="Arix"
                     /note="paired-like homeobox 2a"
                     /db_xref="GeneID:116648"
                     /db_xref="RGD:621323"
     exon            1..413
                     /gene="Phox2a"
                     /gene_synonym="Arix"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    143..145
                     /gene="Phox2a"
                     /gene_synonym="Arix"
                     /note="upstream in-frame stop codon"
     CDS             197..1042
                     /gene="Phox2a"
                     /gene_synonym="Arix"
                     /note="ARIX1 homeodomain protein; aristaless homeobox
                     protein homolog"
                     /codon_start=1
                     /product="paired mesoderm homeobox protein 2A"
                     /protein_id="NP_446321.2"
                     /db_xref="GeneID:116648"
                     /db_xref="RGD:621323"
                     /translation="

MDYSYLNSYDSCVAAMEASAYGDFGACSQPGGFQYSPLRPAFPAAGPPCPALGSSNCALGALRDHQPAPYSAVPYKFFPEPSGLHEKRKQRRIRTTFTSAQLKELERVFAETHYPDIYTREELALKIDLTEARVQVWFQNRRAKFRKQERAASAKGAAGATGAKKGEARCSSEDDDSKESTCSPTPDSTASLPPPPPAPSLASPRLSPSPLPAALGSGPGPQPLKGALWAGVAGGGGGGPGAGAAELLKAWQPAEPGPGPFSGVLSSFHRKPGPALKTNLF"

     misc_feature    order(467..481,485..487,536..538,554..556,593..595,
                     599..604,611..616,620..628,632..637)
                     /gene="Phox2a"
                     /gene_synonym="Arix"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(473..475,482..484,602..604,611..616,623..625)
                     /gene="Phox2a"
                     /gene_synonym="Arix"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    476..634
                     /gene="Phox2a"
                     /gene_synonym="Arix"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    629..853
                     /gene="Phox2a"
                     /gene_synonym="Arix"
                     /note="propagated from UniProtKB/Swiss-Prot (Q62782.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            414..601
                     /gene="Phox2a"
                     /gene_synonym="Arix"
                     /inference="alignment:Splign:2.1.0"
     exon            602..1608
                     /gene="Phox2a"
                     /gene_synonym="Arix"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

cttgcgttgcaccggggcagagtgcgggccgcgacggggcgggcggactctcgggcactcagagtgggtctcaggtcttctgcgcctggagctcgaatctccgtcccgaactccacccagcccgggaccccgacccggaccctgacccggatcagacccggcccggcccggcccccgcccccgccccctcgggccgatggactactcctacctcaattcgtacgattcgtgcgtggcggccatggaggcgtccgcctacggtgacttcggcgcctgcagccagcctggaggcttccaatacagtcccctgcggcctgcctttcccgccgcggggccaccgtgccccgcgctcggctcctccaactgtgcgcttggcgccctacgcgaccaccaacccgcaccctactcggcagttccctacaagttcttcccggagccgtccggcctgcatgagaagcgcaagcagcggcgcatccgcaccacgttcacgagtgctcagctcaaggagttggagcgcgtcttcgccgagacccactacccggacatttacactcgcgaggaactggcgctcaagatcgacctcactgaggctcgcgtgcaggtctggttccagaaccgccgggctaagttccgcaaacaggagcgcgcggccagcgccaaaggcgcggcgggagcgacgggcgccaaaaagggcgaggcgcgttgctcgtccgaggacgacgactccaaggagtccacgtgcagccccacgcccgacagcaccgcgtcgctgccgccgccgccgcccgcacccagcctggccagcccgcgcctgagccccagccctctgcccgccgcgctgggctccgggcccgggccccagccactcaaaggcgcgttgtgggcaggggtggcgggcggtgggggtggcgggcccggcgcgggcgcagcagagctgcttaaggcctggcagccggcggaacccggaccaggtcccttctctggagttctgtcctcctttcaccggaagcccggtcccgccctgaagacaaacctcttctagccgcgggcgtctgtaggcaaccagcctgccccgagagacacccccaccctactggacctgacattatccctccctatcccggcagcctgcctggaagctccccgtcgcccccactacccagtgtctgatccctagaccaggtcccccttcgttgtaaaacaagccagggccactctcgtctggagtactaatcaccaggacccccctccagggcagccggaagccctttcttgctaggcttccttaggagcagggatcaaattgcacctgtccctaactcagagcccagtcatagaggctctaagaagccgagctcctacgacttttcagctagctgggccactcactccttgaaatcaagcaacctgaagagtcccaccgctaatcccaccctaacgagtcacctcccttccctagccagtatgtcgcagagattagacactagaggggaagagctgtcggggaacggaacaaagtggtttccttttcctttattttttttctttgaaaaacgtgtaatttattaaggtgattttgctcaatccaaataaaacttaatttattga

//