LOCUS       NM_053584               2726 bp    mRNA    linear   ROD 22-MAR-2023
DEFINITION  Rattus norvegicus golgi SNAP receptor complex member 1 (Gosr1),
            mRNA.
ACCESSION   NM_053584 XM_579564
VERSION     NM_053584.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2726)
  AUTHORS   Kuliyev E, Gingras S, Guy CS, Howell S, Vogel P and Pelletier S.
  TITLE     Overlapping Role of SCYL1 and SCYL3 in Maintaining Motor Neuron
            Viability
  JOURNAL   J Neurosci 38 (10), 2615-2630 (2018)
   PUBMED   29437892
REFERENCE   2  (bases 1 to 2726)
  AUTHORS   Zhong W, Zhou Y, Li S, Zhou T, Ma H, Wei K, Li H, Olkkonen VM and
            Yan D.
  TITLE     OSBP-related protein 7 interacts with GATE-16 and negatively
            regulates GS28 protein stability
  JOURNAL   Exp Cell Res 317 (16), 2353-2363 (2011)
   PUBMED   21669198
REFERENCE   3  (bases 1 to 2726)
  AUTHORS   Ghosh D, Lippert D, Krokhin O, Cortens JP and Wilkins JA.
  TITLE     Defining the membrane proteome of NK cells
  JOURNAL   J Mass Spectrom 45 (1), 1-25 (2010)
   PUBMED   19946888
REFERENCE   4  (bases 1 to 2726)
  AUTHORS   Suga K, Hattori H, Saito A and Akagawa K.
  TITLE     RNA interference-mediated silencing of the syntaxin 5 gene induces
            Golgi fragmentation but capable of transporting vesicles
  JOURNAL   FEBS Lett 579 (20), 4226-4234 (2005)
   PUBMED   16081076
REFERENCE   5  (bases 1 to 2726)
  AUTHORS   Loh E, Peter F, Subramaniam VN and Hong W.
  TITLE     Mammalian Bet3 functions as a cytosolic factor participating in
            transport from the ER to the Golgi apparatus
  JOURNAL   J Cell Sci 118 (Pt 6), 1209-1222 (2005)
   PUBMED   15728249
REFERENCE   6  (bases 1 to 2726)
  AUTHORS   Zhang T and Hong W.
  TITLE     Ykt6 forms a SNARE complex with syntaxin 5, GS28, and Bet1 and
            participates in a late stage in endoplasmic reticulum-Golgi
            transport
  JOURNAL   J Biol Chem 276 (29), 27480-27487 (2001)
   PUBMED   11323436
REFERENCE   7  (bases 1 to 2726)
  AUTHORS   Sagiv Y, Legesse-Miller A, Porat A and Elazar Z.
  TITLE     GATE-16, a membrane transport modulator, interacts with NSF and the
            Golgi v-SNARE GOS-28
  JOURNAL   EMBO J 19 (7), 1494-1504 (2000)
   PUBMED   10747018
REFERENCE   8  (bases 1 to 2726)
  AUTHORS   Tang BL, Low DY, Lee SS, Tan AE and Hong W.
  TITLE     Molecular cloning and localization of human syntaxin 16, a member
            of the syntaxin family of SNARE proteins
  JOURNAL   Biochem Biophys Res Commun 242 (3), 673-679 (1998)
   PUBMED   9464276
REFERENCE   9  (bases 1 to 2726)
  AUTHORS   Hay JC, Chao DS, Kuo CS and Scheller RH.
  TITLE     Protein interactions regulating vesicle transport between the
            endoplasmic reticulum and Golgi apparatus in mammalian cells
  JOURNAL   Cell 89 (1), 149-158 (1997)
   PUBMED   9094723
REFERENCE   10 (bases 1 to 2726)
  AUTHORS   Subramaniam VN, Peter F, Philp R, Wong SH and Hong W.
  TITLE     GS28, a 28-kilodalton Golgi SNARE that participates in ER-Golgi
            transport
  JOURNAL   Science 272 (5265), 1161-1163 (1996)
   PUBMED   8638159
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            U49099.1, CA338781.1, CB789285.1, CB712832.1, CA512572.1 and
            CB583047.1.
            
            On or before Apr 21, 2005 this sequence version replaced
            XM_579564.1, NM_053584.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC126068.1, FQ235426.1 [ECO:0000332]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-781               U49099.1           9-789
            782-945             CA338781.1         468-631
            946-1220            U49099.1           954-1228
            1221-1236           U49099.1           1230-1245
            1237-1604           U49099.1           1247-1614
            1605-1782           CB789285.1         266-443
            1783-2048           CB712832.1         175-440
            2049-2362           CA512572.1         293-606
            2363-2726           CB583047.1         221-584
FEATURES             Location/Qualifiers
     source          1..2726
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="Sprague-Dawley"
                     /db_xref="taxon:10116"
                     /chromosome="10"
                     /map="10q24"
     gene            1..2726
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /note="golgi SNAP receptor complex member 1"
                     /db_xref="GeneID:94189"
                     /db_xref="RGD:71093"
     exon            1..32
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /inference="alignment:Splign:2.1.0"
     CDS             2..754
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /note="GOS-28; 28 kDa Golgi SNARE protein; 28 kDa
                     cis-Golgi SNARE p28; cis-Golgi p28 (p28)"
                     /codon_start=1
                     /product="Golgi SNAP receptor complex member 1"
                     /protein_id="NP_446036.1"
                     /db_xref="GeneID:94189"
                     /db_xref="RGD:71093"
                     /translation="

MAAGTSNYWEDLRKQARQLENELDLKLVSFSKLCTSYSHSSARDGGRDRYSSDTTPLLNGSSQDRMFETMAIEIEQLLARLTGVNDKMAEYTHSAGVPSLNAALMHTLQRHRDILQDYTHEFHKTKANFMAIRERENLMGSVRKDIESYKSGSGVNNRRTELFLKEHDHLRNSDRLIEETISIAMATKENMTSQRGMLKSIHSKMNTLANRFPAVNSLIQRINLRKRRDSLILGGVIGICTILLLLYAFH"

     misc_feature    5..7
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /note="N-acetylalanine.
                     /evidence=ECO:0000250|UniProtKB:O95249; propagated from
                     UniProtKB/Swiss-Prot (Q62931.1); acetylation site"
     misc_feature    110..178
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /note="propagated from UniProtKB/Swiss-Prot (Q62931.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    422..424
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:O95249; propagated from
                     UniProtKB/Swiss-Prot (Q62931.1); phosphorylation site"
     misc_feature    479..676
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /note="SNARE motif of GS28; Region: SNARE_GS28; cd15864"
                     /db_xref="CDD:277217"
     misc_feature    order(494..502,506..523,527..532,539..544,548..565,
                     569..574,578..586,590..607,611..616,620..628,632..637,
                     641..649,653..658,662..664)
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /note="heterotetramer interface [polypeptide binding];
                     other site"
                     /db_xref="CDD:277217"
     misc_feature    581..583
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /note="zero layer; other site"
                     /db_xref="CDD:277217"
     misc_feature    689..751
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /note="propagated from UniProtKB/Swiss-Prot (Q62931.1);
                     transmembrane region"
     exon            33..153
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /inference="alignment:Splign:2.1.0"
     exon            154..241
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /inference="alignment:Splign:2.1.0"
     exon            242..349
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /inference="alignment:Splign:2.1.0"
     exon            350..441
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /inference="alignment:Splign:2.1.0"
     exon            442..516
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /inference="alignment:Splign:2.1.0"
     exon            517..546
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /inference="alignment:Splign:2.1.0"
     exon            547..629
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /inference="alignment:Splign:2.1.0"
     exon            630..2726
                     /gene="Gosr1"
                     /gene_synonym="GOS28; p28"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gatggcggcgggaaccagcaattactgggaagatcttaggaaacaagctcgacagctggaaaatgaacttgacctgaaactagtttccttcagtaaactgtgtacgagttacagtcacagcagcgcccgggatggaggccgcgataggtatagttctgacacaacacccctattaaatggatcaagccaagacaggatgttcgagacaatggccattgaaattgaacagcttttggcgaggcttacaggagtaaacgacaaaatggcagagtatactcacagtgcaggggtgccctccctgaacgcagccctgatgcacacgctacagcgacacagagacattctgcaggattatacacatgaattccataaaaccaaagcaaactttatggcaatacgggaaagggagaatctcatgggatcagtacgaaaagatattgagtcatataaaagtgggtctggagtaaacaacaggagaactgaactgtttctgaaagaacatgaccaccttcgaaactctgatcgtctgatagaagagacaataagcattgctatggcaacaaaagagaatatgacttcgcagagaggaatgctcaagtccattcacagcaagatgaacactctggccaaccgctttcccgccgtcaacagcctgatacaaaggatcaaccttaggaagcggcgcgactcgctcatccttggaggcgtcattggcatctgcaccatcctgttgctgctgtatgcattccactgagaggtcggccccaggactctgcccaccgcctctgcggcctgctttggaatggggaacctgcaaaggagagagaccgtccggccatgagcctgccagcagatgaattctaaactgcaccgtggctctgacctggtcggcctgagctgaagccacagtttttctgtgctatcttttctaatacatattactctgtttttaattttaaaaacaacaaaaggtttcagttgctgcatctccctaggaggtaagcaagcagaagctgagaacctgggctttagtgactggtgaagccagatgaccagcgggcctcatagctggactcctcacagcaccaggctctacatccaaagatggcctcactttcagccacgagattggatgtgaataaaaataattcttgtccttttatttaacacttgtgatgagaagtcagctgtcctttgctgatactccgtgatccatactctattctgtgtccctaactcttggcagtcaagaaaaattccatttcccacggattctgtaagatgttggtaggccagcttcatgtttgaggcggtctgaaatggaaagtgctatagaaagggtgtctcttttctgtttcagttgtgagccctgggtcaactactgccaccagcacatcagaatggcgggccttacagaggagctggtcattgctttattatttcttcccttgggctgatatttgcttgtattgataaaaatgcatttccagtgatagcccgtcagtgactgtcatcggccctcgaagtcccatatcatgtgaagcttaatactaggaactgaaggagggacttggttctctgtgaggcctgctcgtgagccactgtgagaagacagtgaggggcggctctccagggcttcccatctgtcagtgttgtgcagcctagagcaagggttagcaccgccacctgatgtcacagtactcatgccctgtgcagatctatcccctcctcctctgttaggcttcttcctactcccaggccacaggatgactactgaaggggccggtgactcctacctgtggctatcttactttggacagtgacagaattgtgaatgcttttcaaggttagccatttctcagcatctgtaaatcggtaacttgtcttactcaactagcagatatgttaaagactccaacatgtgtgctcaccaagagagaaggcttccggtccccctggaatgtcctctagcacattgtccacgggcagtgagaggatattagagcgtagcacttcaccattctgtggtgcaggatggtgcctctgggccaacttgatacacttactgcttgctcctggatagactgacacccagtctgagactgactgacaggtttgatattctgctattgaagtgttagtacattctgggtatgaaaggcatttgatatatttttcttaattatggggtttatttttctaaatatgggttaatcggcttgttgactgggcatgccctttaaaggaaattaaatttccctctatggaccttaaagaatcagggaagttcgtttgttaaattctcttttagagagaacagaacttctcttccctgacatttcattatctttgatttttttcaaagggccttgattggcagttgtgcctcagcaggactttatgggactttggttgttatatagtgggcatatataaaatctgaagtatcataaataaagttatttatttaaatatacagccagtcttttctcctggtttgattatgtgcttcgttcactctagctgatgagtgaacgggagctaggacatggccctgccccactgccacagcacagctgctggcagcagacggccgcccaggaggctgcactcagatgaacagtaggattatgttgcttgttttctttttgagagtaaatcagttctttcagggaacgctagctgtagacgctggagacaggagtctgacctcccattgtggtacc

//