GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-11 07:38:57, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_053318               1484 bp    mRNA    linear   ROD 01-JUN-2024
DEFINITION  Rattus norvegicus hemopexin (Hpx), mRNA.
ACCESSION   NM_053318
VERSION     NM_053318.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1484)
  AUTHORS   Detsika,M.G. and Lianos,E.A.
  TITLE     Hemopexin Modulates Expression of Complement Regulatory Proteins in
            Rat Glomeruli
  JOURNAL   Curr Issues Mol Biol 43 (2), 1081-1089 (2021)
   PUBMED   34563046
  REMARK    GeneRIF: Hemopexin Modulates Expression of Complement Regulatory
            Proteins in Rat Glomeruli.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1484)
  AUTHORS   Liu,Y., Tan,C., Li,W., Liu,X., Wang,X., Gui,Y., Qin,L., Deng,F.,
            Hu,C. and Chen,L.
  TITLE     Adenoviral transfer of hemopexin gene attenuates oxidative stress
            and apoptosis in cultured primary cortical neuron cell exposed to
            blood clot
  JOURNAL   Neuroreport 31 (15), 1065-1071 (2020)
   PUBMED   32804709
  REMARK    GeneRIF: Adenoviral transfer of hemopexin gene attenuates oxidative
            stress and apoptosis in cultured primary cortical neuron cell
            exposed to blood clot.
REFERENCE   3  (bases 1 to 1484)
  AUTHORS   Hahl,P., Hunt,R., Bjes,E.S., Skaff,A., Keightley,A. and Smith,A.
  TITLE     Identification of oxidative modifications of hemopexin and their
            predicted physiological relevance
  JOURNAL   J Biol Chem 292 (33), 13658-13671 (2017)
   PUBMED   28596380
  REMARK    GeneRIF: Data suggest that apo-hemopexin isolated from plasma
            exchibits low endogenous levels of tyrosine nitration in the
            peptide YYCFQGNQFLR in the heme-binding site of human hemopexin,
            which was similarly nitrated in rabbit and rat hemopexins; heme
            binding by hemopexin declined as tyrosine nitration proceeded in
            vitro.
REFERENCE   4  (bases 1 to 1484)
  AUTHORS   Bastos-Amador,P., Royo,F., Gonzalez,E., Conde-Vancells,J.,
            Palomo-Diez,L., Borras,F.E. and Falcon-Perez,J.M.
  TITLE     Proteomic analysis of microvesicles from plasma of healthy donors
            reveals high individual variability
  JOURNAL   J Proteomics 75 (12), 3574-3584 (2012)
   PUBMED   22516433
REFERENCE   5  (bases 1 to 1484)
  AUTHORS   Takagi,T., Naito,Y., Okada,H., Takaoka,M., Oya-Ito,T., Yamada,S.,
            Hirai,Y., Mizushima,K., Yoshida,N., Kamada,K., Katada,K.,
            Uchiyama,K., Ishikawa,T., Handa,O., Yagi,N., Konishi,H., Kokura,S.,
            Ichikawa,H. and Yoshikawa,T.
  TITLE     Hemopexin is upregulated in rat intestinal mucosa injured by
            indomethacin
  JOURNAL   J Gastroenterol Hepatol 27 Suppl 3, 70-75 (2012)
   PUBMED   22486875
  REMARK    GeneRIF: Hemopexin was identified as upregulated protein in the
            small intestine exposed to indomethacin.
REFERENCE   6  (bases 1 to 1484)
  AUTHORS   Tolosano,E., Hirsch,E., Patrucco,E., Camaschella,C., Navone,R.,
            Silengo,L. and Altruda,F.
  TITLE     Defective recovery and severe renal damage after acute hemolysis in
            hemopexin-deficient mice
  JOURNAL   Blood 94 (11), 3906-3914 (1999)
   PUBMED   10572107
REFERENCE   7  (bases 1 to 1484)
  AUTHORS   Nagae,Y. and Muller-Eberhard,U.
  TITLE     Identification of an interleukin-6 responsive element and
            characterization of the proximal promoter region of the rat
            hemopexin gene
  JOURNAL   Biochem Biophys Res Commun 185 (1), 420-429 (1992)
   PUBMED   1599480
REFERENCE   8  (bases 1 to 1484)
  AUTHORS   Swerts,J.P., Soula,C., Sagot,Y., Guinaudy,M.J., Guillemot,J.C.,
            Ferrara,P., Duprat,A.M. and Cochard,P.
  TITLE     Hemopexin is synthesized in peripheral nerves but not in central
            nervous system and accumulates after axotomy
  JOURNAL   J Biol Chem 267 (15), 10596-10600 (1992)
   PUBMED   1587840
REFERENCE   9  (bases 1 to 1484)
  AUTHORS   Nikkila,H., Gitlin,J.D. and Muller-Eberhard,U.
  TITLE     Rat hemopexin. Molecular cloning, primary structural
            characterization, and analysis of gene expression
  JOURNAL   Biochemistry 30 (3), 823-829 (1991)
   PUBMED   1988069
REFERENCE   10 (bases 1 to 1484)
  AUTHORS   Wellner,D., Cheng,K.C. and Muller-Eberhard,U.
  TITLE     N-terminal amino acid sequences of the hemopexins from chicken, rat
            and rabbit
  JOURNAL   Biochem Biophys Res Commun 155 (2), 622-625 (1988)
   PUBMED   3421961
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from M62642.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: FQ210231.1, FQ211176.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA5756307, SAMEA5760400
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1484
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="Sprague-Dawley"
                     /db_xref="taxon:10116"
                     /chromosome="1"
                     /map="1q32"
     gene            1..1484
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="hemopexin"
                     /db_xref="GeneID:58917"
                     /db_xref="RGD:62040"
     exon            1..105
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /inference="alignment:Splign:2.1.0"
     CDS             23..1405
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /EC_number="3.2.1.35"
                     /codon_start=1
                     /product="hemopexin precursor"
                     /protein_id="NP_445770.1"
                     /db_xref="GeneID:58917"
                     /db_xref="RGD:62040"
                     /translation="
MARTVVALNILVLLGLCWSLAVANPLPAAHETVAKGENGTKPDSDVIEHCSDAWSFDATTMDHNGTMLFFKGEFVWRGHSGIRELISERWKNPVTSVDAAFRGPDSVFLIKEDKVWVYPPEKKENGYPKLFQEESPGIPYPPDAAVECHRGECQSEGVLFFQGNRKWFWDFATRTQKERSWPAVGNCTAALRWLERYYCFQGNKFLRFNPVTGEVPPRYPLDARDYFISCPGRGHGKLRNGTAHGNSTHPMHSRCNADPGLSALLSDHRGATYAFSGSHYWRLDSSRDGWHSWPIAHHWPQGPSAVDAAFSWDEKVYLIQGTQVYVFLTKGGNNLVSGYPKRLEKELGSPPGISLDTIDAAFSCPGSSKLYVTSGRRLWWLDLKSGAQATWAELSWPHEKVDGALCLEKSLGPYSCSSNGPNLFFIHGPNLYCYSSIDKLNAAKSLPQPQKVNSILGCSQ"
     sig_peptide     23..91
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /inference="COORDINATES: ab initio prediction:SignalP:6.0"
     mat_peptide     92..1402
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /product="hemopexin"
     misc_feature    134..136
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (P20059.3); glycosylation site"
     misc_feature    176..712
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="Hemopexin-like repeats.; Hemopexin is a
                     heme-binding protein that transports heme to the liver.
                     Hemopexin-like repeats occur in vitronectin and some
                     matrix metalloproteinases family (matrixins). The HX
                     repeats of some matrixins bind tissue inhibitor of...;
                     Region: HX; cd00094"
                     /db_xref="CDD:238046"
     misc_feature    179..301
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="propagated from UniProtKB/Swiss-Prot (P20059.3);
                     Region: Hemopexin 1"
     misc_feature    order(191..193,197..199,314..316,320..322,449..451,
                     455..457,584..586,590..592)
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="Metal binding sites [ion binding]; metal-binding
                     site"
                     /db_xref="CDD:238046"
     misc_feature    212..214
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (P20059.3); glycosylation site"
     misc_feature    302..436
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="propagated from UniProtKB/Swiss-Prot (P20059.3);
                     Region: Hemopexin 2"
     misc_feature    437..571
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="propagated from UniProtKB/Swiss-Prot (P20059.3);
                     Region: Hemopexin 3"
     misc_feature    572..712
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="propagated from UniProtKB/Swiss-Prot (P20059.3);
                     Region: Hemopexin 4"
     misc_feature    578..580
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (P20059.3); glycosylation site"
     misc_feature    740..742
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (P20059.3); glycosylation site"
     misc_feature    758..760
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (P20059.3); glycosylation site"
     misc_feature    791..928
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="propagated from UniProtKB/Swiss-Prot (P20059.3);
                     Region: Hemopexin 5"
     misc_feature    827..1396
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="Hemopexin-like repeats.; Hemopexin is a
                     heme-binding protein that transports heme to the liver.
                     Hemopexin-like repeats occur in vitronectin and some
                     matrix metalloproteinases family (matrixins). The HX
                     repeats of some matrixins bind tissue inhibitor of...;
                     Region: HX; cd00094"
                     /db_xref="CDD:238046"
     misc_feature    929..1072
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="propagated from UniProtKB/Swiss-Prot (P20059.3);
                     Region: Hemopexin 6"
     misc_feature    1085..1204
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="propagated from UniProtKB/Swiss-Prot (P20059.3);
                     Region: Hemopexin 7"
     misc_feature    1214..1366
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /note="propagated from UniProtKB/Swiss-Prot (P20059.3);
                     Region: Hemopexin 8"
     exon            106..164
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /inference="alignment:Splign:2.1.0"
     exon            165..236
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /inference="alignment:Splign:2.1.0"
     exon            237..355
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /inference="alignment:Splign:2.1.0"
     exon            356..509
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /inference="alignment:Splign:2.1.0"
     exon            510..722
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /inference="alignment:Splign:2.1.0"
     exon            723..851
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /inference="alignment:Splign:2.1.0"
     exon            852..982
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /inference="alignment:Splign:2.1.0"
     exon            983..1145
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /inference="alignment:Splign:2.1.0"
     exon            1146..1484
                     /gene="Hpx"
                     /gene_synonym="Hpxn"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
tgtgtggtctttgcagctcgccatggctaggacagtagtagcactaaatatcctggtattgctgggcctgtgctggtccctggctgttgccaaccctcttcctgctgcccatgagactgttgctaaaggtgaaaatgggaccaagccagactcagatgtaatcgaacactgctcagatgcctggagctttgacgctaccaccatggatcacaatgggaccatgctgttctttaaaggggagtttgtgtggaggggtcactcagggatccgggagttaatctcagagaggtggaagaatcccgtcacctcagtggatgctgcattccgtggtcctgacagtgtcttcctgatcaaggaagacaaagtctgggtgtatcctcctgaaaagaaagagaacgggtatccaaagttgttccaagaagagtctcctggaatcccatacccaccagacgcagctgtggaatgccaccgtggagaatgccagagtgaaggtgtcctcttcttccaaggtaaccgcaagtggttctgggactttgccacaagaacccaaaaggaacgttcctggcctgctgttgggaattgcactgcggccttgaggtggcttgaacgctactactgcttccagggtaacaagttcctgagatttaaccccgtcacaggagaggtgcctcccagataccctctggatgcccgtgactacttcatatcctgccctggcagaggccatggtaaactaagaaatggaactgctcatgggaatagcacccatcctatgcattcgcgttgtaacgcagatcctggcctgtctgcactgctgtctgaccatcgaggtgccacctatgccttcagtggctcccactactggcgtctggactccagccgtgatgggtggcatagctggcccattgctcatcactggccccagggtccttcagcagtagatgctgccttttcctgggatgagaaagtctatctgatccagggcactcaagtatatgtcttcctgacgaaggggggcaataacctagtaagtggttatccaaagcggctggagaaggaacttgggagccctcccgggatcagccttgataccatagatgcagccttttcctgccctggttcttccaagctctacgtcacatcaggacggcggctttggtggctggacctgaagtcaggagcccaggcgacatgggcagagctttcctggccccatgagaaagttgatggtgccctgtgtttggaaaagtcccttggtccctactcatgctcttccaatggtcccaacttgttctttatccatgggcccaatttatactgctatagcagtatagacaaactgaatgcagccaagagtctgcctcagccccagaaagtgaacagcatccttggctgcagtcaataaaaagccctgatgggaattagcccagcccaccccacctctccatttccattctaataaaaccagatggtttcttcacatg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]