ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-12-13 16:32:56, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_053318 1484 bp mRNA linear ROD 22-JUN-2025
DEFINITION Rattus norvegicus hemopexin (Hpx), mRNA.
ACCESSION NM_053318
VERSION NM_053318.1
KEYWORDS RefSeq; RefSeq Select.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 1484)
AUTHORS Detsika,M.G. and Lianos,E.A.
TITLE Hemopexin Modulates Expression of Complement Regulatory Proteins in
Rat Glomeruli
JOURNAL Curr Issues Mol Biol 43 (2), 1081-1089 (2021)
PUBMED 34563046
REMARK GeneRIF: Hemopexin Modulates Expression of Complement Regulatory
Proteins in Rat Glomeruli.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 1484)
AUTHORS Liu,Y., Tan,C., Li,W., Liu,X., Wang,X., Gui,Y., Qin,L., Deng,F.,
Hu,C. and Chen,L.
TITLE Adenoviral transfer of hemopexin gene attenuates oxidative stress
and apoptosis in cultured primary cortical neuron cell exposed to
blood clot
JOURNAL Neuroreport 31 (15), 1065-1071 (2020)
PUBMED 32804709
REMARK GeneRIF: Adenoviral transfer of hemopexin gene attenuates oxidative
stress and apoptosis in cultured primary cortical neuron cell
exposed to blood clot.
REFERENCE 3 (bases 1 to 1484)
AUTHORS Hahl,P., Hunt,R., Bjes,E.S., Skaff,A., Keightley,A. and Smith,A.
TITLE Identification of oxidative modifications of hemopexin and their
predicted physiological relevance
JOURNAL J Biol Chem 292 (33), 13658-13671 (2017)
PUBMED 28596380
REMARK GeneRIF: Data suggest that apo-hemopexin isolated from plasma
exchibits low endogenous levels of tyrosine nitration in the
peptide YYCFQGNQFLR in the heme-binding site of human hemopexin,
which was similarly nitrated in rabbit and rat hemopexins; heme
binding by hemopexin declined as tyrosine nitration proceeded in
vitro.
REFERENCE 4 (bases 1 to 1484)
AUTHORS Bastos-Amador,P., Royo,F., Gonzalez,E., Conde-Vancells,J.,
Palomo-Diez,L., Borras,F.E. and Falcon-Perez,J.M.
TITLE Proteomic analysis of microvesicles from plasma of healthy donors
reveals high individual variability
JOURNAL J Proteomics 75 (12), 3574-3584 (2012)
PUBMED 22516433
REFERENCE 5 (bases 1 to 1484)
AUTHORS Takagi,T., Naito,Y., Okada,H., Takaoka,M., Oya-Ito,T., Yamada,S.,
Hirai,Y., Mizushima,K., Yoshida,N., Kamada,K., Katada,K.,
Uchiyama,K., Ishikawa,T., Handa,O., Yagi,N., Konishi,H., Kokura,S.,
Ichikawa,H. and Yoshikawa,T.
TITLE Hemopexin is upregulated in rat intestinal mucosa injured by
indomethacin
JOURNAL J Gastroenterol Hepatol 27 Suppl 3, 70-75 (2012)
PUBMED 22486875
REMARK GeneRIF: Hemopexin was identified as upregulated protein in the
small intestine exposed to indomethacin.
REFERENCE 6 (bases 1 to 1484)
AUTHORS Tolosano,E., Hirsch,E., Patrucco,E., Camaschella,C., Navone,R.,
Silengo,L. and Altruda,F.
TITLE Defective recovery and severe renal damage after acute hemolysis in
hemopexin-deficient mice
JOURNAL Blood 94 (11), 3906-3914 (1999)
PUBMED 10572107
REFERENCE 7 (bases 1 to 1484)
AUTHORS Nagae,Y. and Muller-Eberhard,U.
TITLE Identification of an interleukin-6 responsive element and
characterization of the proximal promoter region of the rat
hemopexin gene
JOURNAL Biochem Biophys Res Commun 185 (1), 420-429 (1992)
PUBMED 1599480
REFERENCE 8 (bases 1 to 1484)
AUTHORS Swerts,J.P., Soula,C., Sagot,Y., Guinaudy,M.J., Guillemot,J.C.,
Ferrara,P., Duprat,A.M. and Cochard,P.
TITLE Hemopexin is synthesized in peripheral nerves but not in central
nervous system and accumulates after axotomy
JOURNAL J Biol Chem 267 (15), 10596-10600 (1992)
PUBMED 1587840
REFERENCE 9 (bases 1 to 1484)
AUTHORS Nikkila,H., Gitlin,J.D. and Muller-Eberhard,U.
TITLE Rat hemopexin. Molecular cloning, primary structural
characterization, and analysis of gene expression
JOURNAL Biochemistry 30 (3), 823-829 (1991)
PUBMED 1988069
REFERENCE 10 (bases 1 to 1484)
AUTHORS Wellner,D., Cheng,K.C. and Muller-Eberhard,U.
TITLE N-terminal amino acid sequences of the hemopexins from chicken, rat
and rabbit
JOURNAL Biochem Biophys Res Commun 155 (2), 622-625 (1988)
PUBMED 3421961
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from M62642.1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: FQ210231.1, FQ211176.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMEA5756307, SAMEA5760400
[ECO:0000348]
##Evidence-Data-END##
##RefSeq-Attributes-START##
RefSeq Select criteria :: based on single protein-coding transcript
##RefSeq-Attributes-END##
FEATURES Location/Qualifiers
source 1..1484
/organism="Rattus norvegicus"
/mol_type="mRNA"
/strain="Sprague-Dawley"
/db_xref="taxon:10116"
/chromosome="1"
/map="1q32"
gene 1..1484
/gene="Hpx"
/gene_synonym="Hpxn"
/note="hemopexin"
/db_xref="GeneID:58917"
/db_xref="RGD:62040"
exon 1..105
/gene="Hpx"
/gene_synonym="Hpxn"
/inference="alignment:Splign:2.1.0"
CDS 23..1405
/gene="Hpx"
/gene_synonym="Hpxn"
/EC_number="3.2.1.35"
/codon_start=1
/product="hemopexin precursor"
/protein_id="NP_445770.1"
/db_xref="GeneID:58917"
/db_xref="RGD:62040"
/translation="
MARTVVALNILVLLGLCWSLAVANPLPAAHETVAKGENGTKPDSDVIEHCSDAWSFDATTMDHNGTMLFFKGEFVWRGHSGIRELISERWKNPVTSVDAAFRGPDSVFLIKEDKVWVYPPEKKENGYPKLFQEESPGIPYPPDAAVECHRGECQSEGVLFFQGNRKWFWDFATRTQKERSWPAVGNCTAALRWLERYYCFQGNKFLRFNPVTGEVPPRYPLDARDYFISCPGRGHGKLRNGTAHGNSTHPMHSRCNADPGLSALLSDHRGATYAFSGSHYWRLDSSRDGWHSWPIAHHWPQGPSAVDAAFSWDEKVYLIQGTQVYVFLTKGGNNLVSGYPKRLEKELGSPPGISLDTIDAAFSCPGSSKLYVTSGRRLWWLDLKSGAQATWAELSWPHEKVDGALCLEKSLGPYSCSSNGPNLFFIHGPNLYCYSSIDKLNAAKSLPQPQKVNSILGCSQ"
sig_peptide 23..91
/gene="Hpx"
/gene_synonym="Hpxn"
/inference="COORDINATES: ab initio prediction:SignalP:6.0"
mat_peptide 92..1402
/gene="Hpx"
/gene_synonym="Hpxn"
/product="hemopexin"
misc_feature 134..136
/gene="Hpx"
/gene_synonym="Hpxn"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (P20059.3); glycosylation site"
misc_feature 176..712
/gene="Hpx"
/gene_synonym="Hpxn"
/note="Hemopexin-like repeats.; Hemopexin is a
heme-binding protein that transports heme to the liver.
Hemopexin-like repeats occur in vitronectin and some
matrix metalloproteinases family (matrixins). The HX
repeats of some matrixins bind tissue inhibitor of...;
Region: HX; cd00094"
/db_xref="CDD:238046"
misc_feature 179..301
/gene="Hpx"
/gene_synonym="Hpxn"
/note="propagated from UniProtKB/Swiss-Prot (P20059.3);
Region: Hemopexin 1"
misc_feature order(191..193,197..199,314..316,320..322,449..451,
455..457,584..586,590..592)
/gene="Hpx"
/gene_synonym="Hpxn"
/note="Metal binding sites [ion binding]; metal-binding
site"
/db_xref="CDD:238046"
misc_feature 212..214
/gene="Hpx"
/gene_synonym="Hpxn"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (P20059.3); glycosylation site"
misc_feature 302..436
/gene="Hpx"
/gene_synonym="Hpxn"
/note="propagated from UniProtKB/Swiss-Prot (P20059.3);
Region: Hemopexin 2"
misc_feature 437..571
/gene="Hpx"
/gene_synonym="Hpxn"
/note="propagated from UniProtKB/Swiss-Prot (P20059.3);
Region: Hemopexin 3"
misc_feature 572..712
/gene="Hpx"
/gene_synonym="Hpxn"
/note="propagated from UniProtKB/Swiss-Prot (P20059.3);
Region: Hemopexin 4"
misc_feature 578..580
/gene="Hpx"
/gene_synonym="Hpxn"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (P20059.3); glycosylation site"
misc_feature 740..742
/gene="Hpx"
/gene_synonym="Hpxn"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (P20059.3); glycosylation site"
misc_feature 758..760
/gene="Hpx"
/gene_synonym="Hpxn"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (P20059.3); glycosylation site"
misc_feature 791..928
/gene="Hpx"
/gene_synonym="Hpxn"
/note="propagated from UniProtKB/Swiss-Prot (P20059.3);
Region: Hemopexin 5"
misc_feature 827..1396
/gene="Hpx"
/gene_synonym="Hpxn"
/note="Hemopexin-like repeats.; Hemopexin is a
heme-binding protein that transports heme to the liver.
Hemopexin-like repeats occur in vitronectin and some
matrix metalloproteinases family (matrixins). The HX
repeats of some matrixins bind tissue inhibitor of...;
Region: HX; cd00094"
/db_xref="CDD:238046"
misc_feature 929..1072
/gene="Hpx"
/gene_synonym="Hpxn"
/note="propagated from UniProtKB/Swiss-Prot (P20059.3);
Region: Hemopexin 6"
misc_feature 1085..1204
/gene="Hpx"
/gene_synonym="Hpxn"
/note="propagated from UniProtKB/Swiss-Prot (P20059.3);
Region: Hemopexin 7"
misc_feature 1214..1366
/gene="Hpx"
/gene_synonym="Hpxn"
/note="propagated from UniProtKB/Swiss-Prot (P20059.3);
Region: Hemopexin 8"
exon 106..164
/gene="Hpx"
/gene_synonym="Hpxn"
/inference="alignment:Splign:2.1.0"
exon 165..236
/gene="Hpx"
/gene_synonym="Hpxn"
/inference="alignment:Splign:2.1.0"
exon 237..355
/gene="Hpx"
/gene_synonym="Hpxn"
/inference="alignment:Splign:2.1.0"
exon 356..509
/gene="Hpx"
/gene_synonym="Hpxn"
/inference="alignment:Splign:2.1.0"
exon 510..722
/gene="Hpx"
/gene_synonym="Hpxn"
/inference="alignment:Splign:2.1.0"
exon 723..851
/gene="Hpx"
/gene_synonym="Hpxn"
/inference="alignment:Splign:2.1.0"
exon 852..982
/gene="Hpx"
/gene_synonym="Hpxn"
/inference="alignment:Splign:2.1.0"
exon 983..1145
/gene="Hpx"
/gene_synonym="Hpxn"
/inference="alignment:Splign:2.1.0"
exon 1146..1484
/gene="Hpx"
/gene_synonym="Hpxn"
/inference="alignment:Splign:2.1.0"
ORIGIN
tgtgtggtctttgcagctcgccatggctaggacagtagtagcactaaatatcctggtattgctgggcctgtgctggtccctggctgttgccaaccctcttcctgctgcccatgagactgttgctaaaggtgaaaatgggaccaagccagactcagatgtaatcgaacactgctcagatgcctggagctttgacgctaccaccatggatcacaatgggaccatgctgttctttaaaggggagtttgtgtggaggggtcactcagggatccgggagttaatctcagagaggtggaagaatcccgtcacctcagtggatgctgcattccgtggtcctgacagtgtcttcctgatcaaggaagacaaagtctgggtgtatcctcctgaaaagaaagagaacgggtatccaaagttgttccaagaagagtctcctggaatcccatacccaccagacgcagctgtggaatgccaccgtggagaatgccagagtgaaggtgtcctcttcttccaaggtaaccgcaagtggttctgggactttgccacaagaacccaaaaggaacgttcctggcctgctgttgggaattgcactgcggccttgaggtggcttgaacgctactactgcttccagggtaacaagttcctgagatttaaccccgtcacaggagaggtgcctcccagataccctctggatgcccgtgactacttcatatcctgccctggcagaggccatggtaaactaagaaatggaactgctcatgggaatagcacccatcctatgcattcgcgttgtaacgcagatcctggcctgtctgcactgctgtctgaccatcgaggtgccacctatgccttcagtggctcccactactggcgtctggactccagccgtgatgggtggcatagctggcccattgctcatcactggccccagggtccttcagcagtagatgctgccttttcctgggatgagaaagtctatctgatccagggcactcaagtatatgtcttcctgacgaaggggggcaataacctagtaagtggttatccaaagcggctggagaaggaacttgggagccctcccgggatcagccttgataccatagatgcagccttttcctgccctggttcttccaagctctacgtcacatcaggacggcggctttggtggctggacctgaagtcaggagcccaggcgacatgggcagagctttcctggccccatgagaaagttgatggtgccctgtgtttggaaaagtcccttggtccctactcatgctcttccaatggtcccaacttgttctttatccatgggcccaatttatactgctatagcagtatagacaaactgaatgcagccaagagtctgcctcagccccagaaagtgaacagcatccttggctgcagtcaataaaaagccctgatgggaattagcccagcccaccccacctctccatttccattctaataaaaccagatggtttcttcacatg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]