LOCUS       NM_031332               2157 bp    mRNA    linear   ROD 22-MAR-2023
DEFINITION  Rattus norvegicus solute carrier family 22 member 8 (Slc22a8),
            mRNA.
ACCESSION   NM_031332
VERSION     NM_031332.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2157)
  AUTHORS   Taniguchi T, Omura K, Motoki K, Sakai M, Chikamatsu N, Ashizawa N,
            Takada T and Iwanaga T.
  TITLE     Hypouricemic agents reduce indoxyl sulfate excretion by inhibiting
            the renal transporters OAT1/3 and ABCG2
  JOURNAL   Sci Rep 11 (1), 7232 (2021)
   PUBMED   33790363
  REMARK    GeneRIF: Hypouricemic agents reduce indoxyl sulfate excretion by
            inhibiting the renal transporters OAT1/3 and ABCG2.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 2157)
  AUTHORS   Pengrattanachot N, Cherngwelling R, Jaikumkao K, Pongchaidecha A,
            Thongnak L, Swe MT, Chatsudthipong V and Lungkaphin A.
  TITLE     Atorvastatin attenuates obese-induced kidney injury and impaired
            renal organic anion transporter 3 function through inhibition of
            oxidative stress and inflammation
  JOURNAL   Biochim Biophys Acta Mol Basis Dis 1866 (6), 165741 (2020)
   PUBMED   32101757
  REMARK    GeneRIF: Atorvastatin attenuates obese-induced kidney injury and
            impaired renal organic anion transporter 3 function through
            inhibition of oxidative stress and inflammation.
REFERENCE   3  (bases 1 to 2157)
  AUTHORS   Bush KT, Singh P and Nigam SK.
  TITLE     Gut-derived uremic toxin handling in vivo requires OAT-mediated
            tubular secretion in chronic kidney disease
  JOURNAL   JCI Insight 5 (7), 133817 (2020)
   PUBMED   32271169
  REMARK    GeneRIF: Gut-derived uremic toxin handling in vivo requires
            OAT-mediated tubular secretion in chronic kidney disease.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 2157)
  AUTHORS   Wanchai K, Yasom S, Tunapong W, Chunchai T, Eaimworawuthikul S,
            Thiennimitr P, Chaiyasut C, Pongchaidecha A, Chatsudthipong V,
            Chattipakorn S, Chattipakorn N and Lungkaphin A.
  TITLE     Probiotic Lactobacillus paracasei HII01 protects rats against
            obese-insulin resistance-induced kidney injury and impaired renal
            organic anion transporter 3 function
  JOURNAL   Clin Sci (Lond) 132 (14), 1545-1563 (2018)
   PUBMED   29980603
  REMARK    GeneRIF: Data suggest that a remote sensing and signaling system
            between gut and kidney by which probiotic might facilitate renal
            handling of gut microbiota products through the improvement of
            organic anion transporter 3 (Oat3) function.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 2157)
  AUTHORS   Zhang Z, Tachikawa M, Uchida Y and Terasaki T.
  TITLE     Drug Clearance from Cerebrospinal Fluid Mediated by Organic Anion
            Transporters 1 (Slc22a6) and 3 (Slc22a8) at Arachnoid Membrane of
            Rats
  JOURNAL   Mol Pharm 15 (3), 911-922 (2018)
   PUBMED   29436232
  REMARK    GeneRIF: Study results indicate that Oat1 and Oat3 at the
            blood-arachnoid barrier provide a distinct clearance pathway of
            organic anion drugs from cerebrospinal fluid independently of
            choroid plexus.
REFERENCE   6  (bases 1 to 2157)
  AUTHORS   Feng B, Shu Y and Giacomini KM.
  TITLE     Role of aromatic transmembrane residues of the organic anion
            transporter, rOAT3, in substrate recognition
  JOURNAL   Biochemistry 41 (28), 8941-8947 (2002)
   PUBMED   12102636
  REMARK    GeneRIF: Role of aromatic transmembrane residues in substrate
            recognition
REFERENCE   7  (bases 1 to 2157)
  AUTHORS   Nagata Y, Kusuhara H, Endou H and Sugiyama Y.
  TITLE     Expression and functional characterization of rat organic anion
            transporter 3 (rOat3) in the choroid plexus
  JOURNAL   Mol Pharmacol 61 (5), 982-988 (2002)
   PUBMED   11961115
REFERENCE   8  (bases 1 to 2157)
  AUTHORS   Hasegawa M, Kusuhara H, Sugiyama D, Ito K, Ueda S, Endou H and
            Sugiyama Y.
  TITLE     Functional involvement of rat organic anion transporter 3 (rOat3;
            Slc22a8) in the renal uptake of organic anions
  JOURNAL   J Pharmacol Exp Ther 300 (3), 746-753 (2002)
   PUBMED   11861777
REFERENCE   9  (bases 1 to 2157)
  AUTHORS   Kobayashi Y, Hirokawa N, Ohshiro N, Sekine T, Sasaki T, Tokuyama S,
            Endou H and Yamamoto T.
  TITLE     Differential gene expression of organic anion transporters in male
            and female rats
  JOURNAL   Biochem Biophys Res Commun 290 (1), 482-487 (2002)
   PUBMED   11779196
REFERENCE   10 (bases 1 to 2157)
  AUTHORS   Kusuhara H, Sekine T, Utsunomiya-Tate N, Tsuda M, Kojima R, Cha SH,
            Sugiyama Y, Kanai Y and Endou H.
  TITLE     Molecular cloning and characterization of a new multispecific
            organic anion transporter from rat brain
  JOURNAL   J Biol Chem 274 (19), 13675-13680 (1999)
   PUBMED   10224140
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AB017446.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB017446.1, FQ209755.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA5756307, SAMEA5760393
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..2157
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="Sprague-Dawley"
                     /db_xref="taxon:10116"
                     /chromosome="1"
                     /map="1q43"
     gene            1..2157
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="solute carrier family 22 member 8"
                     /db_xref="GeneID:83500"
                     /db_xref="RGD:632286"
     exon            1..99
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    34..36
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="upstream in-frame stop codon"
     exon            100..456
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /inference="alignment:Splign:2.1.0"
     CDS             124..1734
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="rOat3; solute carrier family 22 (organic anion
                     transporter), member 8; organic anion/dicarboxylate
                     exchanger"
                     /codon_start=1
                     /product="organic anion transporter 3"
                     /protein_id="NP_112622.1"
                     /db_xref="GeneID:83500"
                     /db_xref="RGD:632286"
                     /translation="

MTFSEILDRVGSMGPFQYLHVTLLALPVLGIANHNLLQIFTATTPVHHCRPPPNASIGPWVLPLDPNGKPEKCLRFVHLPNASLPNDTQRATEPCLDGWIYNSTRDTIVIEWDLVCSSNKLKEMAQSIFMAGILVGGPVIGELSDRFGRKPILTWSYLMLAASGSGAAFSPSLPVYMIFRFLCGCSISGISLSTVILNVEWVPTSMRAISSTSIGYCYTIGQFILSGLAYAIPQWRWLQLTSSAPFFIFSLLSWWVPESIRWLVLSGKYSKALKTLQRVATFNGKKEEGKKLTIEELKFNLQKDITSAKVKYGLSDLFRVSILRRVTFCLSLAWFSTGFAYYSLAMGVEEFGVNIYILQIIFGGVDIPAKFITILSLSYLGRRITQSFLLLLAGGAILALIFVPSEMQLLRTALAVFGKGCLSGSFSCLFLYTSELYPTVLRQTGMGISNVWARVGSMIAPLVKITGELQPFIPNVIFGTTALLGGSAAFFLLETLNRPLPETIEDIQNWHKQVQKTKQESEAEKASQIIPLKTGG"

     misc_feature    133..135
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (Q9R1U7.1); phosphorylation site"
     misc_feature    154..1632
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="cation transport protein; Region: 2A0119;
                     TIGR00898"
                     /db_xref="CDD:273328"
     misc_feature    157..219
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9R1U7.1);
                     transmembrane region"
     misc_feature    364..366
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q9R1U7.1); glycosylation site"
     misc_feature    379..381
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q9R1U7.1); glycosylation site"
     misc_feature    493..555
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9R1U7.1);
                     transmembrane region"
     misc_feature    598..660
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9R1U7.1);
                     transmembrane region"
     misc_feature    664..726
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9R1U7.1);
                     transmembrane region"
     misc_feature    760..822
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9R1U7.1);
                     transmembrane region"
     misc_feature    832..894
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9R1U7.1);
                     transmembrane region"
     misc_feature    1105..1167
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9R1U7.1);
                     transmembrane region"
     misc_feature    1186..1248
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9R1U7.1);
                     transmembrane region"
     misc_feature    1273..1335
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9R1U7.1);
                     transmembrane region"
     misc_feature    1357..1419
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9R1U7.1);
                     transmembrane region"
     misc_feature    1537..1599
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9R1U7.1);
                     transmembrane region"
     misc_feature    1666..1731
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9R1U7.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            457..560
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /inference="alignment:Splign:2.1.0"
     exon            561..715
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /inference="alignment:Splign:2.1.0"
     exon            716..884
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /inference="alignment:Splign:2.1.0"
     exon            885..1008
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /inference="alignment:Splign:2.1.0"
     exon            1009..1124
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /inference="alignment:Splign:2.1.0"
     exon            1125..1339
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /inference="alignment:Splign:2.1.0"
     exon            1340..1448
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /inference="alignment:Splign:2.1.0"
     exon            1449..1652
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /inference="alignment:Splign:2.1.0"
     exon            1653..2157
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /inference="alignment:Splign:2.1.0"
     polyA_site      2157
                     /gene="Slc22a8"
                     /gene_synonym="Oat3; OCT3; Roct"
                     /note="34 a nucleotides"
ORIGIN      

ctgagctgtcctaccacagcagccgccggaccctaggacagagcacgggccaccgccgcatccacctccagtccaactggatccagctccaaccaccagttttggttcatcttgcctggtgccatgaccttctccgagattctggaccgtgtcggaagcatgggccccttccagtacctgcatgtgaccttgctggccctcccagtcctcggaatagccaaccacaacttgctacagatcttcacagccaccacccctgtccaccactgtcgcccgccccccaacgcctctatagggccctgggtactccccttggacccaaatgggaagcctgagaagtgtctccgcttcgtacatctgccaaatgccagtcttcccaatgacacccagagggccaccgagccgtgcttggatggctggatctacaacagcaccagagacaccattgtgatagagtgggacttggtgtgcagctccaacaaactgaaggagatggcccagtcgatcttcatggcaggcatactggttggaggacctgtgattggagaactgtcagacaggtttggccgcaagcctatcctgacctggagttatctcatgctggcagccagcggctctggtgctgccttcagtcccagcctccctgtctatatgatcttccgattcctgtgtggctgcagcatctcgggcatttctctgagcaccgttatcttgaatgtggaatgggtacccacctcgatgcgggccatctcatcaacatctattgggtactgctacaccattggtcagttcattctgtccggcctggcctatgccattcctcagtggcgctggctacagttaacctcgtctgctcccttcttcatcttctccttgttgtcctggtgggtaccagagtccatacgctggctggttctatctggaaaatactcaaaggccctgaagacactccaacgggtggctaccttcaacggcaagaaggaggaagggaaaaagctcaccatagaggagctgaagttcaacttgcagaaggacatcacctcagccaaggtcaaatatggcttatctgacttgttccgggtgtccatccttcgtcgtgtgaccttctgtctctctctggcctggttttctactggttttgcctactacagtttggctatgggggtagaagaatttggagtcaacatctacatactccagattatctttggtggggttgacatcccagccaagttcatcacaatcctctccttaagttatctgggccggcgcatcactcagagcttcctcctgctcctagcaggaggggccattttggccctcatctttgtgccttcagaaatgcagctcttgagaacagcactggctgtgtttggaaagggatgcctatctggctccttcagctgcctcttcctctacacgagtgagctctaccctacagtcctcaggcaaacaggtatgggtatcagtaacgtgtgggctcgagtaggaagtatgatagccccactggtgaaaatcacgggtgaactgcagcccttcatccctaatgtcatctttgggaccacggccctactgggaggcagtgctgccttctttctgcttgagaccctcaatcggcccttaccggagactatcgaggacatacaaaactggcacaagcaagtccagaaaacaaagcaggagtcggaagcagaaaaggcatcccaaataatcccgctgaagactggtggataggaccctagctgagaacaacagaatcctctttcctggccacaagagactgatcccaagcagtacccttctggagttccttgggcaccttgggggttggggaaagccctaggtgggcccatgctcttggaacaaaaacttctgagagttcagtaaaggtgttctaccctcatcacctccaccatagcctacaacccagacccggcctgctcacagctctagccataggcttcccatactcctgcactcatcctccctgcagcccagccctgccattcttctgtcaacccttgccatattggccatttcctccattgtcccacctccattttccttgagatcccctagcagttctaatggtttcttcttaccttgcccaaactctctccttggtgggaaatttcaataaaccacaatgaagaactc

//