GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-27 11:02:27, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_031140               1796 bp    mRNA    linear   ROD 23-AUG-2023
DEFINITION  Rattus norvegicus vimentin (Vim), mRNA.
ACCESSION   NM_031140
VERSION     NM_031140.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1796)
  AUTHORS   Coelho NR, Tomkiewicz C, Correia MJ, Goncalves-Dias C, Barouki R,
            Pereira SA, Coumoul X and Monteiro EC.
  TITLE     First evidence of aryl hydrocarbon receptor as a druggable target
            in hypertension induced by chronic intermittent hypoxia
  JOURNAL   Pharmacol Res 159, 104869 (2020)
   PUBMED   32416216
REFERENCE   2  (bases 1 to 1796)
  AUTHORS   Liang JR and Yang H.
  TITLE     Ginkgolic acid (GA) suppresses gastric cancer growth by inducing
            apoptosis and suppressing STAT3/JAK2 signaling regulated by ROS
  JOURNAL   Biomed Pharmacother 125, 109585 (2020)
   PUBMED   32106377
REFERENCE   3  (bases 1 to 1796)
  AUTHORS   Vakhrusheva A, Endzhievskaya S, Zhuikov V, Nekrasova T, Parshina E,
            Ovsiannikova N, Popov V, Bagrov D, Minin Acapital A, Cyrillic and
            Sokolova OS.
  TITLE     The role of vimentin in directional migration of rat fibroblasts
  JOURNAL   Cytoskeleton (Hoboken) 76 (9-10), 467-476 (2019)
   PUBMED   31626376
  REMARK    GeneRIF: The role of vimentin in directional migration of rat
            fibroblasts.
REFERENCE   4  (bases 1 to 1796)
  AUTHORS   Zhu WB, Zhao ZF and Zhou X.
  TITLE     AMD3100 inhibits epithelial-mesenchymal transition, cell invasion,
            and metastasis in the liver and the lung through blocking the
            SDF-1alpha/CXCR4 signaling pathway in prostate cancer
  JOURNAL   J Cell Physiol 234 (7), 11746-11759 (2019)
   PUBMED   30537000
REFERENCE   5  (bases 1 to 1796)
  AUTHORS   Al-Kaabi M, Hussam F, Al-Marsoummi S, Al-Anbaki A, Al-Salihi A and
            Al-Aubaidy H.
  TITLE     Expression of ZO1, vimentin, pan-cadherin and AGTR1 in
            tanycyte-like cells of the sulcus medianus organum
  JOURNAL   Biochem Biophys Res Commun 502 (2), 243-249 (2018)
   PUBMED   29803674
  REMARK    GeneRIF: We labeled brain with ZO1, vimentin, pan-cadherin and
            angiotensin II type 1 receptors markers which showed a
            morphologically distinct population of cells at the region of the
            sulcus medianus organum similar to tanycytes present in the median
            eminence, a known circumventricular organ.
REFERENCE   6  (bases 1 to 1796)
  AUTHORS   Bussemakers MJ, Verhaegh GW, van Bokhoven A, Debruyne FM and
            Schalken JA.
  TITLE     Differential expression of vimentin in rat prostatic tumors
  JOURNAL   Biochem Biophys Res Commun 182 (3), 1254-1259 (1992)
   PUBMED   1540169
REFERENCE   7  (bases 1 to 1796)
  AUTHORS   Bussemakers MJ, van Bokhoven A, van Groningen JJ, Debruyne FM and
            Schalken JA.
  TITLE     Increased expression of retroviral sequences in progressionally
            advanced rat prostatic tumors
  JOURNAL   Biochem Biophys Res Commun 182 (1), 318-324 (1992)
   PUBMED   1370615
REFERENCE   8  (bases 1 to 1796)
  AUTHORS   Monteiro MJ and Cleveland DW.
  TITLE     Expression of NF-L and NF-M in fibroblasts reveals coassembly of
            neurofilament and vimentin subunits
  JOURNAL   J Cell Biol 108 (2), 579-593 (1989)
   PUBMED   2493000
REFERENCE   9  (bases 1 to 1796)
  AUTHORS   Akoglu,T., Kozakoglu,H. and Akoglu,E.
  TITLE     Antibody to intermediate filaments of the cytoskeleton in patients
            with Behcet's disease
  JOURNAL   Clin Immunol Immunopathol 41 (3), 427-432 (1986)
   PUBMED   3780056
REFERENCE   10 (bases 1 to 1796)
  AUTHORS   Kurki,P., Helve,T. and Virtanen,I.
  TITLE     Antibodies to cytoplasmic intermediate filaments in rheumatic
            diseases
  JOURNAL   J Rheumatol 10 (4), 558-562 (1983)
   PUBMED   6352937
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from X62952.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: X62952.1, BC061847.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA5756307, SAMEA5760383
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1796
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="Fischer Copenhagen"
                     /db_xref="taxon:10116"
                     /chromosome="17"
                     /map="17q12.3"
     gene            1..1796
                     /gene="Vim"
                     /note="vimentin"
                     /db_xref="GeneID:81818"
                     /db_xref="RGD:621646"
     exon            1..643
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     CDS             81..1481
                     /gene="Vim"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="NP_112402.1"
                     /db_xref="GeneID:81818"
                     /db_xref="RGD:621646"
                     /translation="
MSTRSVSSSSYRRMFGGSGTSSRPSSNRSYVTTSTRTYSLGSALRPSTSRSLYSSSPGGAYVTRSSAVRLRSSMPGVRLLQDSVDFSLADAINTEFKNTRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGQGKSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLAEDIMRLREKLQEEMLQREEAESTLQSFRQDVDNASLARLDLERKVESLQEEIAFLKKLHDEEIQELQAQIQEQHVQIDVDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQESNEYRRQVQSLTCEVDALKGTNESLERQMREMEENFALEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRISLPLPNFSSLNLRETNLESLPLVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"
     misc_feature    81..179
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P31000.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    84..365
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P31000.2);
                     Region: Head"
     misc_feature    84..86
                     /gene="Vim"
                     /note="N-acetylserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); acetylation site"
     misc_feature    93..95
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    99..101
                     /gene="Vim"
                     /note="O-linked (GlcNAc) serine, alternate.
                     /evidence=ECO:0000250; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); glycosylation site"
     misc_feature    99..101
                     /gene="Vim"
                     /note="Phosphoserine, by PKA and PKC, alternate.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    102..104
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    105..107
                     /gene="Vim"
                     /note="Phosphoserine, by PKC.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    108..110
                     /gene="Vim"
                     /note="Phosphoserine, by PKC.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    120..383
                     /gene="Vim"
                     /note="Intermediate filament head (DNA binding) region;
                     Region: Filament_head; pfam04732"
                     /db_xref="CDD:428095"
     misc_feature    138..140
                     /gene="Vim"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    153..155
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P20152; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    156..158
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P20152; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    177..179
                     /gene="Vim"
                     /note="O-linked (GlcNAc) threonine. /evidence=ECO:0000250;
                     propagated from UniProtKB/Swiss-Prot (P31000.2);
                     glycosylation site"
     misc_feature    180..182
                     /gene="Vim"
                     /note="O-linked (GlcNAc) serine, alternate.
                     /evidence=ECO:0000250; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); glycosylation site"
     misc_feature    180..182
                     /gene="Vim"
                     /note="Phosphoserine, by PKC, alternate.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    195..197
                     /gene="Vim"
                     /note="Phosphoserine, by CaMK2, PKA, PKC and ROCK2.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    204..206
                     /gene="Vim"
                     /note="Phosphoserine, by PKC.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    219..221
                     /gene="Vim"
                     /note="Phosphoserine, by PKA.
                     /evidence=ECO:0000250|UniProtKB:P20152; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    225..227
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    231..233
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    237..239
                     /gene="Vim"
                     /note="Phosphotyrosine.
                     /evidence=ECO:0000250|UniProtKB:P20152; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    243..245
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000269|PubMed:12686602; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    246..248
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    261..263
                     /gene="Vim"
                     /note="Phosphotyrosine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    276..278
                     /gene="Vim"
                     /note="Phosphoserine, by PKA and PKC.
                     /evidence=ECO:0000250|UniProtKB:P20152; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    294..296
                     /gene="Vim"
                     /note="Phosphoserine, by AURKB and ROCK2.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    297..299
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    327..329
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    339..341
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    366..473
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P31000.2);
                     Region: Coil 1A"
     misc_feature    384..1310
                     /gene="Vim"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:425436"
     misc_feature    429..431
                     /gene="Vim"
                     /note="Phosphotyrosine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    438..440
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); acetylation site"
     misc_feature    465..467
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0000250|UniProtKB:P20152; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); acetylation site"
     misc_feature    474..539
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P31000.2);
                     Region: Linker 1"
     misc_feature    495..497
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); acetylation site"
     misc_feature    510..512
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    540..815
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P31000.2);
                     Region: Coil 1B"
     misc_feature    582..584
                     /gene="Vim"
                     /note="N6-acetyllysine.
                     /evidence=ECO:0000250|UniProtKB:P20152; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); acetylation site"
     misc_feature    642..644
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0000250|UniProtKB:P20152; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); acetylation site"
     misc_feature    720..722
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    747..749
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0000250|UniProtKB:P20152; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); acetylation site"
     misc_feature    756..758
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    783..785
                     /gene="Vim"
                     /note="N6-acetyllysine.
                     /evidence=ECO:0000250|UniProtKB:P20152; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); acetylation site"
     misc_feature    816..884
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P31000.2);
                     Region: Linker 12"
     misc_feature    885..1301
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P31000.2);
                     Region: Coil 2"
     misc_feature    960..962
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0000250|UniProtKB:P20152; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); acetylation site"
     misc_feature    975..977
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    1053..1055
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P20152; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    1056..1067
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P31000.2);
                     Region: [IL]-x-C-x-x-[DE] motif.
                     /evidence=ECO:0000250|UniProtKB:P08670"
     misc_feature    1131..1133
                     /gene="Vim"
                     /note="Stutter. /evidence=ECO:0000250; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); other site"
     misc_feature    1197..1199
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); acetylation site"
     misc_feature    1302..1478
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P31000.2);
                     Region: Tail"
     misc_feature    1305..1307
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    1314..1316
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    1335..1337
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    1338..1340
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    1356..1358
                     /gene="Vim"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    1368..1370
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    1386..1388
                     /gene="Vim"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    1392..1394
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    1413..1415
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); acetylation site"
     misc_feature    1416..1418
                     /gene="Vim"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    1452..1454
                     /gene="Vim"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     misc_feature    1455..1457
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P31000.2); phosphorylation site"
     exon            644..704
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            705..800
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            801..962
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            963..1088
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            1089..1309
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            1310..1353
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            1354..1439
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            1440..1796
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gttcacagccactgcgccctcgctctcttcttgcagatcttgcagccgcagcaagccaggccacctcgtccttcgaagccatgtccaccaggtccgtgtcctcgtcctcctaccgcaggatgttcggtggctccggcacatcgagccggcccagctccaaccggagctatgtgaccacatccacccgcacctacagcctaggcagcgcgctgcgccccagcactagccgcagcctctattcctcgtccccgggtggcgcctatgtgacccggtcctccgccgtgcgcctgcggagcagcatgcccggcgtgcggctgctgcaggactccgtggacttctcgctggccgacgccatcaacaccgagttcaagaacacccgcaccaacgagaaggtggaattgcaggagctgaatgaccgcttcgccaactacatcgacaaggtgcgcttcctcgagcagcagaacaaaatcctgctggccgagctcgagcagcttaagggccagggcaagtcgcgcctgggcgacctctacgaggaggagatgagggagttgcgccggcaggtggatcagctcaccaatgacaaggcccgtgtcgaggtggagagggacaacctggccgaggacatcatgcggctgcgagaaaaattgcaggaggagatgctccagagggaggaagccgagagcaccctgcagtcattcagacaggatgttgacaatgcttctctggcacgtcttgaccttgaacgtaaagtggaatccttgcaggaagaaattgcctttttgaagaagctgcacgatgaagagatccaggagctgcaggcccagattcaggaacagcatgtccagatcgatgtggacgtttccaagcctgacctcaccgctgccctgcgtgatgtccgccagcagtatgaaagtgtggctgccaagaacctccaggaggccgaggaatggtacaagtccaagtttgctgacctctctgaggctgccaaccggaacaacgatgccctgcgccaggcaaagcaggagtcaaacgaataccggagacaggtgcagtcactcacctgcgaagtggatgcccttaaaggcactaatgagtccctggagcgccagatgcgtgaaatggaagagaattttgcccttgaagctgctaactaccaggacactattggccgcctgcaggatgagatccagaacatgaaggaagagatggctcgccaccttcgtgaataccaggacctgctcaatgtaaagatggctcttgacattgagatcgccacctacaggaagctgctggaaggggaggagagcaggatttctctgcctcttccaaacttttcttccctgaacctgagagaaactaacctggagtcacttcctctggttgacacccactccaaaagaacactcctgattaagacggttgaaaccagagacggacaggtgatcaatgagacttctcagcaccacgatgaccttgaataaaaactgcacaggctcagtgcaacggcgcagtaccagcaagaaggaaaaaaaaatcgtatcttagaaaaaagagctttcaagtgcctttactgcagttttcaggagcgcaagatagatctgggatagaaacgagctcagcacataacaactgacacccccaaaaggcgtagaaaaggtttacaaaataatctagttttacgaagaaatcttgtgctagaatactttttaaagtatttttgaataccattaaaactgctttctttttccagaaaatatctgaccaacttgttactgcttcaataaaacttcagaaat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]