LOCUS       NM_024394               2002 bp    mRNA    linear   ROD 21-NOV-2023
DEFINITION  Rattus norvegicus 5-hydroxytryptamine receptor 3A (Htr3a), mRNA.
ACCESSION   NM_024394
VERSION     NM_024394.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2002)
  AUTHORS   Belliveau S, Kang W, Bovaird S, Hamadjida A, Bedard D, Dancause N,
            Stroh T and Huot P.
  TITLE     Stereological investigation of 5-HT3 receptors in the substantia
            nigra and dorsal raphe nucleus in the rat
  JOURNAL   J Chem Neuroanat 111, 101881 (2021)
   PUBMED   33160048
  REMARK    GeneRIF: Stereological investigation of 5-HT3 receptors in the
            substantia nigra and dorsal raphe nucleus in the rat.
REFERENCE   2  (bases 1 to 2002)
  AUTHORS   Domocos D, Selescu T, Ceafalan LC, Iodi Carstens M, Carstens E and
            Babes A.
  TITLE     Role of 5-HT1A and 5-HT3 receptors in serotonergic activation of
            sensory neurons in relation to itch and pain behavior in the rat
  JOURNAL   J Neurosci Res 98 (10), 1999-2017 (2020)
   PUBMED   32537854
  REMARK    GeneRIF: Role of 5-HT1A and 5-HT3 receptors in serotonergic
            activation of sensory neurons in relation to itch and pain behavior
            in the rat.
            Erratum:[J Neurosci Res. 2023 Jan;101(1):196. PMID: 36250251]
REFERENCE   3  (bases 1 to 2002)
  AUTHORS   Nakamori H, Naitou K, Sano Y, Shimaoka H, Shiina T and Shimizu Y.
  TITLE     Exogenous serotonin regulates colorectal motility via the 5-HT2 and
            5-HT3 receptors in the spinal cord of rats
  JOURNAL   Neurogastroenterol Motil 30 (3) (2018)
   PUBMED   28795477
  REMARK    GeneRIF: Results demonstrate that exogenous serotonin acts on 5-HT2
            and 5-HT3 receptors in the lumbosacral defecation center and
            activates the parasympathetic nervous system to enhance colorectal
            motility in cooperation with noradrenaline and dopamine.
REFERENCE   4  (bases 1 to 2002)
  AUTHORS   Imada T, Nakamura S, Hisamura R, Izuta Y, Jin K, Ito M, Kitamura N,
            Tanaka KF, Mimura M, Shibuya I and Tsubota K.
  TITLE     Serotonin hormonally regulates lacrimal gland secretory function
            via the serotonin type 3a receptor
  JOURNAL   Sci Rep 7 (1), 6965 (2017)
   PUBMED   28761086
  REMARK    GeneRIF: Results found that 5-HT3aR plays a role in lacrimal gland
            secretory functions and confirmed that extracellular Ca2+ entry
            participates in [Ca2+]i mobilization stimulated by 5-HT.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 2002)
  AUTHORS   Pratt WE, Lin P, Pierce-Messick Z, Ilesanmi AO and Clissold KA.
  TITLE     Contrasting effects of 5-HT3 receptor stimulation of the nucleus
            accumbens or ventral tegmentum on food intake in the rat
  JOURNAL   Behav Brain Res 323, 15-23 (2017)
   PUBMED   28115218
  REMARK    GeneRIF: Data support a functional role for serotonergic signaling
            in the mesolimbic pathway on motivated behavior, and demonstrate
            that 5-HT3 serotonin receptors differentially modulate food
            consumption in a region-dependent manner.
REFERENCE   6  (bases 1 to 2002)
  AUTHORS   Hanna MC, Davies PA, Hales TG and Kirkness EF.
  TITLE     Evidence for expression of heteromeric serotonin 5-HT(3) receptors
            in rodents
  JOURNAL   J Neurochem 75 (1), 240-247 (2000)
   PUBMED   10854267
REFERENCE   7  (bases 1 to 2002)
  AUTHORS   Davies PA, Pistis M, Hanna MC, Peters JA, Lambert JJ, Hales TG and
            Kirkness EF.
  TITLE     The 5-HT3B subunit is a major determinant of serotonin-receptor
            function
  JOURNAL   Nature 397 (6717), 359-363 (1999)
   PUBMED   9950429
REFERENCE   8  (bases 1 to 2002)
  AUTHORS   Miyake A, Mochizuki S, Takemoto Y and Akuzawa S.
  TITLE     Molecular cloning of human 5-hydroxytryptamine3 receptor:
            heterogeneity in distribution and function among species
  JOURNAL   Mol Pharmacol 48 (3), 407-416 (1995)
   PUBMED   7565620
REFERENCE   9  (bases 1 to 2002)
  AUTHORS   Miquel MC, Emerit MB, Gingrich JA, Nosjean A, Hamon M and el
            Mestikawy S.
  TITLE     Developmental changes in the differential expression of two
            serotonin 5-HT3 receptor splice variants in the rat
  JOURNAL   J Neurochem 65 (2), 475-483 (1995)
   PUBMED   7616200
REFERENCE   10 (bases 1 to 2002)
  AUTHORS   Isenberg KE, Ukhun IA, Holstad SG, Jafri S, Uchida U, Zorumski CF
            and Yang J.
  TITLE     Partial cDNA cloning and NGF regulation of a rat 5-HT3 receptor
            subunit
  JOURNAL   Neuroreport 5 (2), 121-124 (1993)
   PUBMED   7509203
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JACYVU010000198.1.
            
            On Nov 27, 2020 this sequence version replaced NM_024394.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support SAMD00132261,
                              SAMD00132262 [ECO:0000350]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-176               JACYVU010000198.1  11067525-11067700   c
            177-343             JACYVU010000198.1  11065164-11065330   c
            344-388             JACYVU010000198.1  11063953-11063997   c
            389-498             JACYVU010000198.1  11062880-11062989   c
            499-668             JACYVU010000198.1  11061009-11061178   c
            669-829             JACYVU010000198.1  11057822-11057982   c
            830-1040            JACYVU010000198.1  11057285-11057495   c
            1041-1262           JACYVU010000198.1  11056612-11056833   c
            1263-2002           JACYVU010000198.1  11055331-11056070   c
FEATURES             Location/Qualifiers
     source          1..2002
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="8"
                     /map="8q23"
     gene            1..2002
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /note="5-hydroxytryptamine receptor 3A"
                     /db_xref="GeneID:79246"
                     /db_xref="RGD:61818"
     exon            1..176
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    20..22
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /note="upstream in-frame stop codon"
     CDS             110..1561
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /note="5-HT3 receptor; 5-HT-3; 5-HT3R; serotonin receptor
                     3A; serotonin-gated ion channel receptor; 5-HT3-A;
                     5-hydroxytryptamine receptor 3; 5-hydroxytryptamine
                     (serotonin) receptor 3A, ionotropic"
                     /codon_start=1
                     /product="5-hydroxytryptamine receptor 3A precursor"
                     /protein_id="NP_077370.2"
                     /db_xref="GeneID:79246"
                     /db_xref="RGD:61818"
                     /translation="

MPLCIPQVLLALFLSVLIAQGEGSRRRATQAHSTTQPALLRLSDHLLANYKKGVRPVRDWRKPTLVSIDVIMYAILNVDEKNQVLTTYIWYRQFWTDEFLQWTPEDFDNVTKLSIPTDSIWVPDILINEFVDVGKSPSIPYVYVHHQGEVQNYKPLQLVTACSLDIYNFPFDVQNCSLTFTSWLHTIQDINISLWRTPEEVRSDKSIFINQGEWELLGVFTKFQEFSIETSNSYAEMKFYVVIRRRPLFYAVSLLLPSIFLMVVDIVGFCLPPDSGERVSFKITLLLGYSVFLIIVSDTLPATAIGTPLIGVYFVVCMALLVISLAETIFIVQLVHKQDLQRPVPDWLRHLVLDRIAWLLCLGEQPMAHRPPATFQANKTDDCSAMGNHCSHVGSPQDLEKTSRSRDSPLPPPREASLAVRGLLQELSSIRHSLEKRDEMREVARDWLRVGYVLDRLLFRIYLLAVLAYSITLVTLWSIWHYS"

     sig_peptide     110..178
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    122..1540
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /note="Cation transporter family protein; Region: LIC;
                     TIGR00860"
                     /db_xref="CDD:273305"
     mat_peptide     179..1558
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /product="5-hydroxytryptamine receptor 3A.
                     /id=PRO_0000000410"
                     /note="propagated from UniProtKB/Swiss-Prot (P35563.2)"
     misc_feature    434..436
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (P35563.2); glycosylation site"
     misc_feature    632..634
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (P35563.2); glycosylation site"
     misc_feature    680..682
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (P35563.2); glycosylation site"
     misc_feature    848..928
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /note="propagated from UniProtKB/Swiss-Prot (P35563.2);
                     transmembrane region"
     misc_feature    944..1000
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /note="propagated from UniProtKB/Swiss-Prot (P35563.2);
                     transmembrane region"
     misc_feature    1031..1087
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /note="propagated from UniProtKB/Swiss-Prot (P35563.2);
                     transmembrane region"
     misc_feature    1286..1351
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /note="propagated from UniProtKB/Swiss-Prot (P35563.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1364..1474
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /note="propagated from UniProtKB/Swiss-Prot (P35563.2);
                     Region: HA-stretch, determines single-channel conductance
                     in 5-HT3 receptors.
                     /evidence=ECO:0000250|UniProtKB:P46098"
     misc_feature    1490..1549
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /note="propagated from UniProtKB/Swiss-Prot (P35563.2);
                     transmembrane region"
     exon            177..343
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /inference="alignment:Splign:2.1.0"
     exon            344..388
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /inference="alignment:Splign:2.1.0"
     exon            389..498
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /inference="alignment:Splign:2.1.0"
     exon            499..668
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /inference="alignment:Splign:2.1.0"
     exon            669..829
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /inference="alignment:Splign:2.1.0"
     exon            830..1040
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /inference="alignment:Splign:2.1.0"
     exon            1041..1262
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /inference="alignment:Splign:2.1.0"
     exon            1263..2002
                     /gene="Htr3a"
                     /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

aagcagcctgcctgggacatgaggttggcagcgggtgtgcaggctggcagtctgggggactcatcctgagtggctgctccgaggccctcccacatccgggaagcttgccatgccgctctgcatcccgcaggtgctgttggccttgttcctttccgtgctgatagcccagggagaaggcagccggaggagggccacccaggcccacagcaccacccagcctgctctgctgaggctgtcagatcacctcctggctaactacaagaagggggtgcggcctgtgcgggactggaggaagcccaccctggtctccatcgatgtcatcatgtatgccatcctcaacgtggatgagaagaaccaggttctgacaacctacatatggtaccggcagttctggaccgacgagtttctacagtggactcctgaggacttcgacaatgtcaccaaattgtccatccccaccgacagcatctgggtccctgacatcctcatcaatgagtttgtggacgtggggaagtctccaagcattccttatgtgtatgtgcaccatcaaggtgaagtccagaactacaagcccctacagctggtgaccgcctgtagccttgacatctataacttcccgttcgatgtgcagaactgctctctgaccttcaccagctggctgcataccatccaggacatcaacatttccctgtggcgaacaccagaagaagtgaggtcggacaagagcatcttcataaatcagggcgagtgggagctgctgggggtgttcaccaaatttcaggagttcagtatagaaaccagtaacagctatgcggaaatgaagttctacgtggtcatccgccggcggcctttattctacgcagtcagcctcttgctgcccagtatcttcctcatggttgtggacattgtgggcttttgtctgcccccggacagtggtgagagagtgtctttcaagatcacgctccttctgggatactcagtctttctcatcatcgtgtcagacacactgcctgcaacggccatcggcactcccctcattggtgtctactttgtagtgtgcatggctctgctggtgataagcctcgctgagaccatcttcattgtgcagctggtgcataagcaggatttacagcgccctgtacctgactggctgaggcacctggtcctagacagaatagcctggctgctctgcctaggggagcagcccatggcccataggcccccagccaccttccaagccaacaagactgatgactgctcagccatgggaaaccactgcagccatgtcggaagccctcaggacttggagaagacctcgaggagcagagatagccctcttccaccaccaagggaggcctcgctggctgtgcgtggcctcttgcaagagctgtcctccatccgccactccctggagaagcgggatgagatgcgggaggtggcaagggactggttgcgggtgggatatgtgctggacaggctgctgtttcgcatctacctgctggccgtgctggcttacagcatcaccctggtcacgctctggtccatttggcattattcctgagtgggtacagcctggcagggaggggatgtgagtcctgcatcctgtttccaacaccaattcatctgagcaaccccagtccccttgtcccctaaacttagcactgaagacccggtcagaccccccgacttcgctatcatgactttaaagcatgatatcctagatcaagaggaaccaagactcctctaacttattaagacatcaagccctggttccttttccagtacttctgtgattatggcccttgggatggctcatttccacagttttttttttcctttttgatcagaggaaagcaaattctcttgcctaggtgcctgagacgtctgtgcctgttttatccaggccccagtggcttcttcttcagctcacttgtgggtacttccctagcgctcagcctcatcaaccaacggggggagggaataataaaatgctatgatatcc

//