2024-03-29 02:14:32, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_024389 2938 bp mRNA linear ROD 22-SEP-2023 DEFINITION Rattus norvegicus homeo box A5 (Hoxa5), mRNA. ACCESSION NM_024389 XM_003752180 VERSION NM_024389.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 2938) AUTHORS Kato H, Ario T, Kishida T, Tadano M, Osawa S, Maeda Y, Takakura H and Izawa T. TITLE Homeobox A5 and C10 genes modulate adaptation of brown adipose tissue during exercise training in juvenile rats JOURNAL Exp Physiol 106 (2), 463-474 (2021) PUBMED 33369800 REMARK GeneRIF: Homeobox A5 and C10 genes modulate adaptation of brown adipose tissue during exercise training in juvenile rats. REFERENCE 2 (bases 1 to 2938) AUTHORS Wang Y, Wang MD, Xia YP, Gao Y, Zhu YY, Chen SC, Mao L, He QW, Yue ZY and Hu B. TITLE MicroRNA-130a regulates cerebral ischemia-induced blood-brain barrier permeability by targeting Homeobox A5 JOURNAL FASEB J 32 (2), 935-944 (2018) PUBMED 29070584 REMARK GeneRIF: MiR-130a, by inhibiting Homeobox A5 expression, could down-regulate occludin, thereby increasing BBB permeability. Our results suggested that miR-130a might be implicated in ischemia-induced BBB dysfunction and serve as a target for the treatment of ischemic stroke REFERENCE 3 (bases 1 to 2938) AUTHORS Jakob P, Doerries C, Briand S, Mocharla P, Krankel N, Besler C, Mueller M, Manes C, Templin C, Baltes C, Rudin M, Adams H, Wolfrum M, Noll G, Ruschitzka F, Luscher TF and Landmesser U. TITLE Loss of angiomiR-126 and 130a in angiogenic early outgrowth cells from patients with chronic heart failure: role for impaired in vivo neovascularization and cardiac repair capacity JOURNAL Circulation 126 (25), 2962-2975 (2012) PUBMED 23136161 REFERENCE 4 (bases 1 to 2938) AUTHORS Chen Y and Gorski DH. TITLE Regulation of angiogenesis through a microRNA (miR-130a) that down-regulates antiangiogenic homeobox genes GAX and HOXA5 JOURNAL Blood 111 (3), 1217-1226 (2008) PUBMED 17957028 REFERENCE 5 (bases 1 to 2938) AUTHORS McIntyre DC, Rakshit S, Yallowitz AR, Loken L, Jeannotte L, Capecchi MR and Wellik DM. TITLE Hox patterning of the vertebrate rib cage JOURNAL Development 134 (16), 2981-2989 (2007) PUBMED 17626057 REFERENCE 6 (bases 1 to 2938) AUTHORS Zhao JJ, Lazzarini RA and Pick L. TITLE Functional dissection of the mouse Hox-a5 gene JOURNAL EMBO J 15 (6), 1313-1322 (1996) PUBMED 8635464 REFERENCE 7 (bases 1 to 2938) AUTHORS Pellerin I, Schnabel C, Catron KM and Abate C. TITLE Hox proteins have different affinities for a consensus DNA site that correlate with the positions of their genes on the hox cluster JOURNAL Mol Cell Biol 14 (7), 4532-4545 (1994) PUBMED 7911971 REFERENCE 8 (bases 1 to 2938) AUTHORS Gorski DH, LePage DF and Walsh K. TITLE Cloning and sequence analysis of homeobox transcription factor cDNAs with an inosine-containing probe JOURNAL Biotechniques 16 (5), 856-858 (1994) PUBMED 7915120 REFERENCE 9 (bases 1 to 2938) AUTHORS Jeannotte L, Lemieux M, Charron J, Poirier F and Robertson EJ. TITLE Specification of axial identity in the mouse: role of the Hoxa-5 (Hox1.3) gene JOURNAL Genes Dev 7 (11), 2085-2096 (1993) PUBMED 7901120 REFERENCE 10 (bases 1 to 2938) AUTHORS Odenwald WF, Taylor CF, Palmer-Hill FJ, Friedrich V Jr, Tani M and Lazzarini RA. TITLE Expression of a homeo domain protein in noncontact-inhibited cultured cells and postmitotic neurons JOURNAL Genes Dev 1 (5), 482-496 (1987) PUBMED 2890554 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JACYVU010000142.1. On Oct 25, 2019 this sequence version replaced XM_003752180.2. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BU758364.1, BQ782052.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA5760494, SAMN16676788 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-2386 JACYVU010000142.1 4537249-4539634 c 2387-2938 JACYVU010000142.1 4535741-4536292 c FEATURES Location/Qualifiers source 1..2938 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="4" /map="4q24" gene 1..2938 /gene="Hoxa5" /note="homeo box A5" /db_xref="GeneID:79241" /db_xref="RGD:620609" exon 1..2386 /gene="Hoxa5" /inference="alignment:Splign:2.1.0" misc_feature 1432..1434 /gene="Hoxa5" /note="upstream in-frame stop codon" CDS 1492..2637 /gene="Hoxa5" /note="hox-1.3; homeobox protein Hox-1.3; homeobox protein Hox-A5-like" /codon_start=1 /product="homeobox protein Hox-A5" /protein_id="NP_077365.1" /db_xref="GeneID:79241" /db_xref="RGD:620609" /translation="
MRPVSSGWRSSPTERRRRVAGTRPGSARHPSRLHPTPPLLHEFTSRGHQAGFTTGQQKHVIRSRTPYLGAYVGGNRVHVPVISIIHHKLCKGAIDAQTTASHKSSTHIKKQMSSYFVNSFCGRYPNGPDYQLHNYGDHSSVSEQFRDSASMHSGRYGYGYNGMDLSVGRSGSGHFGSGERARSYAAGASAAPAEPRYSQPATSTHSPPPDPLPCSAVAPSPGSDSHHGGKNSLGNSSGASANAGSTHISSREGVGTASAAEEDAPASSEQAGAQSEPSPAPPAQPQIYPWMRKLHISHDNIGGPEGKRARTAYTRYQTLELEKEFHFNRYLTRRRRIEIAHALCLSERQIKIWFQNRRMKWKKDNKLKSMSMAAAGGAFRP"
misc_feature order(2410..2424,2428..2430,2479..2481,2497..2499, 2536..2538,2542..2547,2554..2559,2563..2571,2575..2580) /gene="Hoxa5" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(2416..2418,2425..2427,2545..2547,2554..2559, 2566..2568) /gene="Hoxa5" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 2419..2577 /gene="Hoxa5" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" exon 2387..2938 /gene="Hoxa5" /inference="alignment:Splign:2.1.0" ORIGIN
cacacacacacacacacacacacacacacaggttttctccccaaggctgcccgagccagcttgggaatcccggggtgcacccagaattggtcctgctgctgtgttagcgtctctgcgccctgtgagctacagacgcggggttgttgggggaagaaggagccccaggcagtgccccgtttggtgcctgggtttttccgccttggtccctcgccatcaaatcctaaagggcatcgccaaatcgactctggctactgaaaagaaagggtccacaagctgggccccagccctgtcccggcctctcaggatgcccctaaacaagaagcctgaggaacaaaggggaactcgccccttccccgacagaaccaaatctctctaccggcgcatacccgtcagtgggagagtagcagcctcaacggaggcaagccaacctgggcgcgagaggaacgttacaacctcgggagcgactaggctcctgcaggctcccagctcccgatttcactcccagcctcataagctgaccgccgccacctaaccgctttcaggacccaaagagggggcccaggaccatgagagccgcaagagtcctggcttccaaacgtgccagggactcctgagatgccaggcctctagtagagaaagtctcttctcctctcagctacatttgtgatttactttcgtctatcggagcccaggaaaataactacggtgatactaggcactgccacgaaatgattccattagttcccgcaatttattcccagtggtctaagcgagatcccaatagctctacccacggatcccagcttccaagcagcctcggaggccgttgggtatcagggcccactctctgggttcaccaagaaccctgctacctggggccgggctagtcagaagaaacggaccagggacgaagatcttccaggctggataaataaacaaatgagatagcaaactaatgacacgaaaaacatattttcacggaagaaaaaaatgattctggttatacgagtgtatggaatttgacctcgcctcggagaaacactacacaaaagctgtctttaatagacgcctgtggtttaagagcggcagggacactgtccttcatgcgctcacaaacacagagccataattgtggctgctgctgtgggcaggatttatttcttcaattggctaaatcgtcttcccttcctcgaaggtgatatctgtgttttcaaaattcacagctgctagccgggcgggcaaaccgaccccaacctccacacaaaaataagaggggatacaaagctggggaaataaagttgttgtaaataattctaagtcatcacctccccctaatcctctgtatcctcgccgggtgtgcgatcggcagctgacggcctcacaattggtacatcctaatggaactgcgagggaaatgcaataattttgccataatgggctgtaacctcaattcgaccccggcccttgctgcccgaggtcggaagcggagcgatgcgcccagtctccagcgggtggcgctcgagtccgactgaacggcggcggcgggtggcgggcacgcgcccagggagcgcgcgccacccctctcgcctccacccaactcccccattactgcacgagtttacctctagaggtcatcaggcaggatttacgactggacaacaaaagcacgtgattcgaagtcgtaccccatatttgggtgcctacgtaggagggaaccgagtacatgtcccagtcatttccataattcatcataaattgtgcaagggtgctatagacgcacaaacgaccgcgagccacaaatcaagcacacatatcaaaaaacaaatgagctcttattttgtaaactcattttgcggtcgctatccaaatggcccggactaccagttgcataattatggagatcatagttccgtgagcgaacaattcagggactcggcgagcatgcactccggcaggtacggctacggctacaatggcatggatctcagcgtcggccgttcgggttccggccactttggctccggcgagcgcgcccgcagctacgcggctggggccagtgcggcgcccgccgagcccaggtacagccagccggccacgtccacgcactcgccaccgcccgacccgctgccctgctcagcggtggccccctcgcccggcagcgacagccaccacggcgggaaaaactccctgggcaactccagcggcgcctcggccaacgccggcagcacccacatcagcagcagagagggggttggcacggcgtccgcagcggaggaggacgcccctgccagcagcgagcaggcgggcgcccagagcgagccgagcccggcgccgcccgctcaaccccagatctacccctggatgcgcaagctgcacattagtcacgacaacataggtggcccagaaggcaaaagggcccggacggcctacacgcgctaccagaccctggagctggagaaagaattccacttcaaccgctacctgacccgccgaagaaggattgaaatagcacatgccctttgcctctccgagagacaaattaaaatctggttccaaaacaggaggatgaagtggaaaaaggataataagctgaaaagtatgagtatggccgcggcagggggggccttccgcccctgaggttctgagcggccaaagtactgggcagtagtagcgcgcggagcaactctccgtagtgtcagtactaaggtgactttctgaaactccccttgtgttccttctgtgaagaagccctgttctcgttgccctaattcatcttttaatcatgagcctgtttattgccattatagcgcctgtataagtagatcagcttctgttcatctctttgtcctgaatggctttgtcttgaaaaaaaaaatagatgttttaacttatttatatgaagcaagctgtgttacttgaagtaactaaaacaaaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]