2024-04-27 02:00:59, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_020102 1308 bp mRNA linear ROD 28-JUN-2023 DEFINITION Rattus norvegicus MOS proto-oncogene, serine/threonine kinase (Mos), mRNA. ACCESSION NM_020102 XM_346731 VERSION NM_020102.4 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1308) AUTHORS Suzuki T, Suzuki E, Yoshida N, Kubo A, Li H, Okuda E, Amanai M and Perry AC. TITLE Mouse Emi2 as a distinctive regulatory hub in second meiotic metaphase JOURNAL Development 137 (19), 3281-3291 (2010) PUBMED 20724447 REFERENCE 2 (bases 1 to 1308) AUTHORS Perrard MH, Chassaing E, Montillet G, Sabido O and Durand P. TITLE Cytostatic factor proteins are present in male meiotic cells and beta-nerve growth factor increases mos levels in rat late spermatocytes JOURNAL PLoS One 4 (10), e7237 (2009) PUBMED 19802389 REMARK GeneRIF: NGF, by enhancing Mos in late spermatocytes, is one of the intra-testicular factors which adjusts the number of round spermatids that can be supported by Sertoli cells Publication Status: Online-Only REFERENCE 3 (bases 1 to 1308) AUTHORS Nishimura T, Shimaoka T, Kano K and Naito K. TITLE Insufficient amount of Cdc2 and continuous activation of Wee1 B are the cause of meiotic failure in porcine growing oocytes JOURNAL J Reprod Dev 55 (5), 553-557 (2009) PUBMED 19550110 REFERENCE 4 (bases 1 to 1308) AUTHORS Ohashi S, Naito K, Sugiura K, Iwamori N, Goto S, Naruoka H and Tojo H. TITLE Analyses of mitogen-activated protein kinase function in the maturation of porcine oocytes JOURNAL Biol Reprod 68 (2), 604-609 (2003) PUBMED 12533425 REFERENCE 5 (bases 1 to 1308) AUTHORS Kim MH, Yuan X, Okumura S and Ishikawa F. TITLE Successful inactivation of endogenous Oct-3/4 and c-mos genes in mouse preimplantation embryos and oocytes using short interfering RNAs JOURNAL Biochem Biophys Res Commun 296 (5), 1372-1377 (2002) PUBMED 12207927 REFERENCE 6 (bases 1 to 1308) AUTHORS Colledge WH, Carlton MB, Udy GB and Evans MJ. TITLE Disruption of c-mos causes parthenogenetic development of unfertilized mouse eggs JOURNAL Nature 370 (6484), 65-68 (1994) PUBMED 8015609 REFERENCE 7 (bases 1 to 1308) AUTHORS Sonakul D and Fucharoen S. TITLE Brain pathology in 6 fatal cases of post-transfusion hypertension, convulsion and cerebral hemorrhage syndrome JOURNAL Southeast Asian J Trop Med Public Health 23 Suppl 2, 116-119 (1992) PUBMED 1298984 REMARK Review article REFERENCE 8 (bases 1 to 1308) AUTHORS Leibovitch SA, Lenormand JL, Leibovitch MP, Guiller M, Mallard L and Harel J. TITLE Rat myogenic c-mos cDNA: cloning sequence analysis and regulation during muscle development JOURNAL Oncogene 5 (8), 1149-1157 (1990) PUBMED 1697408 REFERENCE 9 (bases 1 to 1308) AUTHORS van der Hoorn,F.A. and Firzlaff,J. TITLE Complete c-mos (rat) nucleotide sequence: presence of conserved domains in c-mos proteins JOURNAL Nucleic Acids Res 12 (4), 2147-2156 (1984) PUBMED 6322135 REFERENCE 10 (bases 1 to 1308) AUTHORS Williams,A.F., Barclay,A.N., Letarte-Muirhead,M. and Morris,R.J. TITLE Rat thy-1 antigens from thymus and brain: their tissue distribution, purification, and chemical composition JOURNAL Cold Spring Harb Symp Quant Biol 41 Pt 1, 51-61 (1977) PUBMED 70317 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JACYVU010000160.1. On Sep 20, 2014 this sequence version replaced NM_020102.3. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript is intronless :: X52952.1 [ECO:0000345] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1308 JACYVU010000160.1 4868058-4869365 c FEATURES Location/Qualifiers source 1..1308 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="5" /map="5q12" gene 1..1308 /gene="Mos" /note="MOS proto-oncogene, serine/threonine kinase" /db_xref="GeneID:24559" /db_xref="RGD:3103" exon 1..1308 /gene="Mos" /inference="alignment:Splign:2.1.0" CDS 171..1199 /gene="Mos" /EC_number="2.7.11.1" /note="c-mos; oocyte maturation factor mos; proto-oncogene c-Mos; v-mos moloney murine sarcoma viral oncogene homolog; Moloney murine sarcoma viral (v-mos) oncogene homolog; Moloney sarcoma oncogene" /codon_start=1 /product="proto-oncogene serine/threonine-protein kinase mos" /protein_id="NP_064487.3" /db_xref="GeneID:24559" /db_xref="RGD:3103" /translation="
MPSPLILCRYLPRELSPTVDSRSCSSPLVASRKAGKFLGATPPRAPRLSRRLAWCFIDWGQVCLLHRLGSGGFGSVYKATYHGVPVAIKQVNKCTRNLRASQRSFWAELNIARLHHDNIVRVVAASTRTPEGSNSLGTIIMEFGGNVTLHQVIYGATRSPEPLSCREQLSLGKCLKYSLDIVNGLLFLHSQSILHLDLKPANILISEKDVCKISDFGCSQKLQDLRCRQASLHHIGGTYTHQAPELLKGEIATPKADIYSFGITLWQMTTREVPYSGEPQYVQYAVVAYNLRPSLAGAVFTASLTGKTLQNIVQSCWEARALQRPGAELLQKDLKAFRGALG"
misc_feature 342..1157 /gene="Mos" /note="Catalytic domain of the Serine/Threonine kinase, Oocyte maturation factor Mos; Region: STKc_Mos; cd13979" /db_xref="CDD:270881" misc_feature order(372..386,396..398,429..431,435..437,528..530, 591..602,612..614,618..620,759..761,765..767,771..776, 780..782,813..815,822..824,879..890) /gene="Mos" /note="active site" /db_xref="CDD:270881" misc_feature order(372..386,396..398,429..431,435..437,528..530, 591..602,612..614,759..761,765..767,771..776,780..782, 813..815) /gene="Mos" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270881" misc_feature order(384..386,612..614,618..620,759..761,765..767, 771..773,822..824,879..890) /gene="Mos" /note="polypeptide substrate binding site [polypeptide binding]; other site" /db_xref="CDD:270881" misc_feature order(810..857,870..890) /gene="Mos" /note="activation loop (A-loop); other site" /db_xref="CDD:270881" ORIGIN
accttgctgagcagcaagacgtgagagcacagttgtggctggttttgagaatacaagaagaagggaaatgggatgaaggcggaaaccttcagccatgcttccaaacttccctgggtgttcctggtcatttctctctagcgtctcttgtgactgtcccatctgagggtgtaatgccttcgcctctcatcctgtgtcgctacctccctcgcgagctgtcgccaacggtggactcgaggtcctgcagcagccccttggtggcctcgaggaaggcggggaagttcctgggggccactcctcctcgggccccgcggctgtcacgccggctggcctggtgcttcatagactggggacaggtatgcctgctgcataggctgggttctggagggtttggctcggtgtacaaagccacttaccacggtgttcctgtggccatcaagcaagtgaacaagtgcaccaggaacctacgtgcatcccagcggagtttctgggctgaactgaacattgcaaggctgcaccacgacaacatagtccgggttgtggctgccagcacgcgcacgccggaaggttccaacagccttggtaccataatcatggagtttgggggcaatgtgactctacaccaagtcatctacggtgccacccgctccccagagcctctcagctgcagagagcaactgagtttgggaaagtgcctcaagtattccctagatattgttaacggcctgctttttctccactcacaaagcattttgcacttggacctgaagccagcgaacattttgatcagtgagaaggacgtttgtaagataagtgacttcggctgctcccagaagcttcaggatctgcggtgccggcaggcgtcccttcaccacatcgggggcacgtacacgcaccaagctccggagctcctgaaaggagagatcgccacgcccaaagccgacatctactcttttggcatcaccctgtggcagatgaccaccagggaggtgccttactccggcgagcctcagtacgtgcagtacgcagtggtagcctacaatctgcgcccgtcactggcaggggcggtgttcaccgcctccctgactgggaagacgctgcagaacatcgtccagagctgctgggaggcccgcgccctgcagaggccgggtgcagaactgctccagaaggacctgaaggctttccgaggggcactgggctgactccatcgagcctgtgtgcagataagcttttcgtttctgtttatttttaaataagtaaggatgggcttttagggcatatttttagaaaataaagttactacaaacttca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]