2024-04-27 13:02:09, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_017179 2388 bp mRNA linear ROD 20-MAR-2023 DEFINITION Rattus norvegicus UNC homeobox (Uncx), mRNA. ACCESSION NM_017179 XM_001065224 VERSION NM_017179.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 2388) AUTHORS Sammeta N, Hardin DL and McClintock TS. TITLE Uncx regulates proliferation of neural progenitor cells and neuronal survival in the olfactory epithelium JOURNAL Mol Cell Neurosci 45 (4), 398-407 (2010) PUBMED 20692344 REFERENCE 2 (bases 1 to 2388) AUTHORS Leitges M, Neidhardt L, Haenig B, Herrmann BG and Kispert A. TITLE The paired homeobox gene Uncx4.1 specifies pedicles, transverse processes and proximal ribs of the vertebral column JOURNAL Development 127 (11), 2259-2267 (2000) PUBMED 10804169 REFERENCE 3 (bases 1 to 2388) AUTHORS Mansouri A, Voss AK, Thomas T, Yokota Y and Gruss P. TITLE Uncx4.1 is required for the formation of the pedicles and proximal ribs and acts upstream of Pax9 JOURNAL Development 127 (11), 2251-2258 (2000) PUBMED 10804168 REFERENCE 4 (bases 1 to 2388) AUTHORS Saito T, Lo L, Anderson DJ and Mikoshiba K. TITLE Identification of novel paired homeodomain protein related to C. elegans unc-4 as a potential downstream target of MASH1 JOURNAL Dev Biol 180 (1), 143-155 (1996) PUBMED 8948581 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from JACYVU010000225.1. On Nov 26, 2020 this sequence version replaced NM_017179.1. ##Evidence-Data-START## Transcript exon combination :: D87748.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA5760393, SAMEA5760433 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-785 JACYVU010000225.1 1795868-1796652 c 786-961 JACYVU010000225.1 1795516-1795691 c 962-2388 JACYVU010000225.1 1792131-1793557 c FEATURES Location/Qualifiers source 1..2388 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="12" /map="12q11" gene 1..2388 /gene="Uncx" /gene_synonym="Chx4; PHD1; Uncx4.1" /note="UNC homeobox" /db_xref="GeneID:29375" /db_xref="RGD:69361" exon 1..785 /gene="Uncx" /gene_synonym="Chx4; PHD1; Uncx4.1" /inference="alignment:Splign:2.1.0" misc_feature 434..436 /gene="Uncx" /gene_synonym="Chx4; PHD1; Uncx4.1" /note="upstream in-frame stop codon" CDS 500..2092 /gene="Uncx" /gene_synonym="Chx4; PHD1; Uncx4.1" /note="homeobox protein Uncx4.1; paired-type homeodomain transcription factor 1; Unc4.1 homeobox" /codon_start=1 /product="homeobox protein unc-4 homolog" /protein_id="NP_058875.2" /db_xref="GeneID:29375" /db_xref="RGD:69361" /translation="
MMDGRLLEHPHAQFGGSLGGVVGFPYPLGHHHVYELAGHQLQSAAAAAAAASVPFSIDGLLSGSCAAAAASVVNPTPLLPAACGVAGESQPFKLADSGDPDKESPGCKRRRTRTNFTGWQLEELEKAFNESHYPDVFMREALALRLDLVESRVQVWFQNRRAKWRKKENTKKGPGRPAHNSHPTTCSGEPMDPEEIARKELEKMEKKKRKHEKKLLKSQSRHLHSPGGLSLHSAPSSDSDSGGGGLSPEPPEPPPPTASAKGPGAHGSGIAGSAPVPPGEPPAPGTCDPAFYPSQRSGAGSQPRLGRPADKDTVPCGPGAASTAGLPKASPFSVESLLSDSPPRRKATPANTAATAGLDFTPGLPCAPRTLIGKGHFLLYPITQPLGFLVPQAALKGGAGPELVPKDAPPAPPAPPAPPAQASFGAFPGPVGAADPAFARRSPEVVASPGPPAPASFRDLAAAAAESGAGDCADAGTVCPAAPPPPPLETSPGPGPRAPSPPGEPATCGAAEPGAATGSSPPEGEEVDMD"
misc_feature 767..832 /gene="Uncx" /gene_synonym="Chx4; PHD1; Uncx4.1" /note="propagated from UniProtKB/Swiss-Prot (P97830.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature order(827..841,845..847,896..898,914..916,953..955, 959..964,971..976,980..988,992..997) /gene="Uncx" /gene_synonym="Chx4; PHD1; Uncx4.1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 833..994 /gene="Uncx" /gene_synonym="Chx4; PHD1; Uncx4.1" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(833..835,842..844,962..964,971..976,983..985) /gene="Uncx" /gene_synonym="Chx4; PHD1; Uncx4.1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 992..1585 /gene="Uncx" /gene_synonym="Chx4; PHD1; Uncx4.1" /note="propagated from UniProtKB/Swiss-Prot (P97830.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature <1364..2071 /gene="Uncx" /gene_synonym="Chx4; PHD1; Uncx4.1" /note="large tegument protein UL36; Provisional; Region: PHA03247" /db_xref="CDD:223021" misc_feature 1697..2089 /gene="Uncx" /gene_synonym="Chx4; PHD1; Uncx4.1" /note="propagated from UniProtKB/Swiss-Prot (P97830.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" exon 786..961 /gene="Uncx" /gene_synonym="Chx4; PHD1; Uncx4.1" /inference="alignment:Splign:2.1.0" exon 962..2388 /gene="Uncx" /gene_synonym="Chx4; PHD1; Uncx4.1" /inference="alignment:Splign:2.1.0" ORIGIN
atttgccgctcaatgtctctctgtaattggagcaacatcactttaaaggttcagagagtacagcatttctggtgaaaaatccccacaacacgccggcgaatgttttaaagggaaatctattagaaggaggcaaggggcgggagcggcggggggcaggagtggggggctcgccagggcccccggccggccgagcgcggcggcgcccctccctccccaccccgtcttgttgtgacagctcctgatactgtttatggaggtgcgtgtcaggtataattagcaatcgatatggaaaacgtttccttgcacccagcacgcctctgacgtcagagccgattagcgcttcttattggtcccaaattccccgggccgcggctaattatcgagagcttgatgttgataaagtaaagcggcggagcgcgggccgaagcatgtgtagggctccgggcccctgtccccgccgccgtccgcgcccccgcgccccaccagccccgcgcgcgagatgatggacggtcgcctcctggagcacccgcatgcccagttcgggggctcgctgggcggcgtggtgggcttcccctacccgctgggccaccaccacgtgtacgagctggccggtcaccagctgcagtcggccgccgccgccgccgccgcggcctcggtgcccttctccatcgacggcctgctcagcggctcgtgcgctgcagcagccgcctcggtggtcaaccccacgccgctgctgccggccgcctgcggggtggcgggcgaaagccagcccttcaagcttgcagactcgggggatccagacaaggagagccccggctgcaaacggagacgcacccgcactaacttcaccggctggcagctggaggagctggagaaggcattcaatgagagccactacccggacgtgttcatgcgcgaggcgctggcgctgcgcctggacctggtcgagtcccgagttcaggtctggttccaaaatcgccgggccaagtggagaaagaaggagaacaccaagaagggcccgggccggccagcccacaactcgcacccgaccacgtgcagcggggagcccatggacccggaggagatcgctcgcaaggaactggagaagatggagaagaagaaacgcaaacacgagaagaaactgctcaagagtcagagccgccacctgcactcgcccggtggcctgtccctgcacagcgcgcctagctcagacagcgacagcggtggcggaggcctgtctccagagccacccgagcctccaccgccgaccgcctcggccaagggccctggagcgcacggctctggcatcgcgggctccgctccggtacctcctggcgagccacccgcgcctggcacctgcgaccccgccttctacccgagccaaagaagcggcgccggctcgcagccgcggctaggccgcccggcggacaaggacacggtcccttgcgggcccggagcggcgtcgactgcaggcctgcctaaggctagcccgttcagcgtggagagcctgctgtccgactcgccaccgcgccgcaaagccaccccagccaacactgcggccacagcggggttggacttcacgccggggctgccgtgcgcacctcggaccctgattggcaagggccacttcttgctctaccccatcacgcagcccctcggcttcctggtgccacaggcagcgctcaagggaggagcaggccctgagttggtgcccaaggacgcgccccccgcgccgcccgcgccgcccgcaccgcccgcgcaggccagcttcggggccttccccggacctgttggcgctgcggacccggctttcgcccgtcgcagccctgaggttgttgcctcccctgggccaccggctcccgcttctttccgggacctagcagcggcggcagcggagagcggtgccggggactgcgcggacgcggggaccgtctgccccgcggccccgccgcccccgcccctcgaaacgtcgcccggtccgggccccagagcccccagtccacccggagagccagccacttgcggcgccgctgagccgggcgctgctacgggatccagcccgcccgagggcgaggaggtggacatggactgagctggggaccgcggccggaagaggcgcttagccagccgagcccgctcgctcagccccagactcccaacgaatcaggtgatcggctcttagagacattgcttttccctcctgctttttttcccttccttttattattatttttaaaggcaaacgaaaacgctgtgtcgatggggaccaaggcagcagctgcaggtcctggggtgaggtcccctccttaggagggatcaaaagaccccgtatcccctaacccacaaaaaccccacaacgagaatcctcagccttgtaaaatgcaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]