GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-27 13:02:09, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_017179               2388 bp    mRNA    linear   ROD 20-MAR-2023
DEFINITION  Rattus norvegicus UNC homeobox (Uncx), mRNA.
ACCESSION   NM_017179 XM_001065224
VERSION     NM_017179.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2388)
  AUTHORS   Sammeta N, Hardin DL and McClintock TS.
  TITLE     Uncx regulates proliferation of neural progenitor cells and
            neuronal survival in the olfactory epithelium
  JOURNAL   Mol Cell Neurosci 45 (4), 398-407 (2010)
   PUBMED   20692344
REFERENCE   2  (bases 1 to 2388)
  AUTHORS   Leitges M, Neidhardt L, Haenig B, Herrmann BG and Kispert A.
  TITLE     The paired homeobox gene Uncx4.1 specifies pedicles, transverse
            processes and proximal ribs of the vertebral column
  JOURNAL   Development 127 (11), 2259-2267 (2000)
   PUBMED   10804169
REFERENCE   3  (bases 1 to 2388)
  AUTHORS   Mansouri A, Voss AK, Thomas T, Yokota Y and Gruss P.
  TITLE     Uncx4.1 is required for the formation of the pedicles and proximal
            ribs and acts upstream of Pax9
  JOURNAL   Development 127 (11), 2251-2258 (2000)
   PUBMED   10804168
REFERENCE   4  (bases 1 to 2388)
  AUTHORS   Saito T, Lo L, Anderson DJ and Mikoshiba K.
  TITLE     Identification of novel paired homeodomain protein related to C.
            elegans unc-4 as a potential downstream target of MASH1
  JOURNAL   Dev Biol 180 (1), 143-155 (1996)
   PUBMED   8948581
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JACYVU010000225.1.
            
            On Nov 26, 2020 this sequence version replaced NM_017179.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: D87748.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA5760393, SAMEA5760433
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-785               JACYVU010000225.1  1795868-1796652     c
            786-961             JACYVU010000225.1  1795516-1795691     c
            962-2388            JACYVU010000225.1  1792131-1793557     c
FEATURES             Location/Qualifiers
     source          1..2388
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="12"
                     /map="12q11"
     gene            1..2388
                     /gene="Uncx"
                     /gene_synonym="Chx4; PHD1; Uncx4.1"
                     /note="UNC homeobox"
                     /db_xref="GeneID:29375"
                     /db_xref="RGD:69361"
     exon            1..785
                     /gene="Uncx"
                     /gene_synonym="Chx4; PHD1; Uncx4.1"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    434..436
                     /gene="Uncx"
                     /gene_synonym="Chx4; PHD1; Uncx4.1"
                     /note="upstream in-frame stop codon"
     CDS             500..2092
                     /gene="Uncx"
                     /gene_synonym="Chx4; PHD1; Uncx4.1"
                     /note="homeobox protein Uncx4.1; paired-type homeodomain
                     transcription factor 1; Unc4.1 homeobox"
                     /codon_start=1
                     /product="homeobox protein unc-4 homolog"
                     /protein_id="NP_058875.2"
                     /db_xref="GeneID:29375"
                     /db_xref="RGD:69361"
                     /translation="
MMDGRLLEHPHAQFGGSLGGVVGFPYPLGHHHVYELAGHQLQSAAAAAAAASVPFSIDGLLSGSCAAAAASVVNPTPLLPAACGVAGESQPFKLADSGDPDKESPGCKRRRTRTNFTGWQLEELEKAFNESHYPDVFMREALALRLDLVESRVQVWFQNRRAKWRKKENTKKGPGRPAHNSHPTTCSGEPMDPEEIARKELEKMEKKKRKHEKKLLKSQSRHLHSPGGLSLHSAPSSDSDSGGGGLSPEPPEPPPPTASAKGPGAHGSGIAGSAPVPPGEPPAPGTCDPAFYPSQRSGAGSQPRLGRPADKDTVPCGPGAASTAGLPKASPFSVESLLSDSPPRRKATPANTAATAGLDFTPGLPCAPRTLIGKGHFLLYPITQPLGFLVPQAALKGGAGPELVPKDAPPAPPAPPAPPAQASFGAFPGPVGAADPAFARRSPEVVASPGPPAPASFRDLAAAAAESGAGDCADAGTVCPAAPPPPPLETSPGPGPRAPSPPGEPATCGAAEPGAATGSSPPEGEEVDMD"
     misc_feature    767..832
                     /gene="Uncx"
                     /gene_synonym="Chx4; PHD1; Uncx4.1"
                     /note="propagated from UniProtKB/Swiss-Prot (P97830.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    order(827..841,845..847,896..898,914..916,953..955,
                     959..964,971..976,980..988,992..997)
                     /gene="Uncx"
                     /gene_synonym="Chx4; PHD1; Uncx4.1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    833..994
                     /gene="Uncx"
                     /gene_synonym="Chx4; PHD1; Uncx4.1"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(833..835,842..844,962..964,971..976,983..985)
                     /gene="Uncx"
                     /gene_synonym="Chx4; PHD1; Uncx4.1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    992..1585
                     /gene="Uncx"
                     /gene_synonym="Chx4; PHD1; Uncx4.1"
                     /note="propagated from UniProtKB/Swiss-Prot (P97830.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    <1364..2071
                     /gene="Uncx"
                     /gene_synonym="Chx4; PHD1; Uncx4.1"
                     /note="large tegument protein UL36; Provisional; Region:
                     PHA03247"
                     /db_xref="CDD:223021"
     misc_feature    1697..2089
                     /gene="Uncx"
                     /gene_synonym="Chx4; PHD1; Uncx4.1"
                     /note="propagated from UniProtKB/Swiss-Prot (P97830.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            786..961
                     /gene="Uncx"
                     /gene_synonym="Chx4; PHD1; Uncx4.1"
                     /inference="alignment:Splign:2.1.0"
     exon            962..2388
                     /gene="Uncx"
                     /gene_synonym="Chx4; PHD1; Uncx4.1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atttgccgctcaatgtctctctgtaattggagcaacatcactttaaaggttcagagagtacagcatttctggtgaaaaatccccacaacacgccggcgaatgttttaaagggaaatctattagaaggaggcaaggggcgggagcggcggggggcaggagtggggggctcgccagggcccccggccggccgagcgcggcggcgcccctccctccccaccccgtcttgttgtgacagctcctgatactgtttatggaggtgcgtgtcaggtataattagcaatcgatatggaaaacgtttccttgcacccagcacgcctctgacgtcagagccgattagcgcttcttattggtcccaaattccccgggccgcggctaattatcgagagcttgatgttgataaagtaaagcggcggagcgcgggccgaagcatgtgtagggctccgggcccctgtccccgccgccgtccgcgcccccgcgccccaccagccccgcgcgcgagatgatggacggtcgcctcctggagcacccgcatgcccagttcgggggctcgctgggcggcgtggtgggcttcccctacccgctgggccaccaccacgtgtacgagctggccggtcaccagctgcagtcggccgccgccgccgccgccgcggcctcggtgcccttctccatcgacggcctgctcagcggctcgtgcgctgcagcagccgcctcggtggtcaaccccacgccgctgctgccggccgcctgcggggtggcgggcgaaagccagcccttcaagcttgcagactcgggggatccagacaaggagagccccggctgcaaacggagacgcacccgcactaacttcaccggctggcagctggaggagctggagaaggcattcaatgagagccactacccggacgtgttcatgcgcgaggcgctggcgctgcgcctggacctggtcgagtcccgagttcaggtctggttccaaaatcgccgggccaagtggagaaagaaggagaacaccaagaagggcccgggccggccagcccacaactcgcacccgaccacgtgcagcggggagcccatggacccggaggagatcgctcgcaaggaactggagaagatggagaagaagaaacgcaaacacgagaagaaactgctcaagagtcagagccgccacctgcactcgcccggtggcctgtccctgcacagcgcgcctagctcagacagcgacagcggtggcggaggcctgtctccagagccacccgagcctccaccgccgaccgcctcggccaagggccctggagcgcacggctctggcatcgcgggctccgctccggtacctcctggcgagccacccgcgcctggcacctgcgaccccgccttctacccgagccaaagaagcggcgccggctcgcagccgcggctaggccgcccggcggacaaggacacggtcccttgcgggcccggagcggcgtcgactgcaggcctgcctaaggctagcccgttcagcgtggagagcctgctgtccgactcgccaccgcgccgcaaagccaccccagccaacactgcggccacagcggggttggacttcacgccggggctgccgtgcgcacctcggaccctgattggcaagggccacttcttgctctaccccatcacgcagcccctcggcttcctggtgccacaggcagcgctcaagggaggagcaggccctgagttggtgcccaaggacgcgccccccgcgccgcccgcgccgcccgcaccgcccgcgcaggccagcttcggggccttccccggacctgttggcgctgcggacccggctttcgcccgtcgcagccctgaggttgttgcctcccctgggccaccggctcccgcttctttccgggacctagcagcggcggcagcggagagcggtgccggggactgcgcggacgcggggaccgtctgccccgcggccccgccgcccccgcccctcgaaacgtcgcccggtccgggccccagagcccccagtccacccggagagccagccacttgcggcgccgctgagccgggcgctgctacgggatccagcccgcccgagggcgaggaggtggacatggactgagctggggaccgcggccggaagaggcgcttagccagccgagcccgctcgctcagccccagactcccaacgaatcaggtgatcggctcttagagacattgcttttccctcctgctttttttcccttccttttattattatttttaaaggcaaacgaaaacgctgtgtcgatggggaccaaggcagcagctgcaggtcctggggtgaggtcccctccttaggagggatcaaaagaccccgtatcccctaacccacaaaaaccccacaacgagaatcctcagccttgtaaaatgcaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]