GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 16:07:37, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_017149               2247 bp    mRNA    linear   ROD 20-MAR-2023
DEFINITION  Rattus norvegicus mesenchyme homeobox 2 (Meox2), mRNA.
ACCESSION   NM_017149
VERSION     NM_017149.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2247)
  AUTHORS   Shi H, Duan L, Lan Y, He Q, Pu P and Tang H.
  TITLE     RING Finger Protein 10 Regulates AP-1/Meox2 to Mediate
            Pirarubicin-Induced Cardiomyocyte Apoptosis
  JOURNAL   Oxid Med Cell Longev 2023, 7872193 (2023)
   PUBMED   36713029
  REMARK    GeneRIF: RING Finger Protein 10 Regulates AP-1/Meox2 to Mediate
            Pirarubicin-Induced Cardiomyocyte Apoptosis.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 2247)
  AUTHORS   Liu P, Feng J, Kong F, Lu Q, Xu H, Meng J and Jiang Y.
  TITLE     Gax inhibits perivascular preadipocyte biofunction mediated by
            IGF-1 induced FAK/Pyk2 and ERK2 cooperative pathways
  JOURNAL   Cell Signal 26 (12), 3036-3045 (2014)
   PUBMED   25280940
  REMARK    GeneRIF: The present study was designed to investigate whether
            FAK/Pyk2 and ERK1/2 MAPK signaling pathways participate in
            Perivascular adipocyte functions, which is activated by
            insulin-like growth factor 1(IGF-1) and inhibited by Gax.
REFERENCE   3  (bases 1 to 2247)
  AUTHORS   Cunnington RH, Northcott JM, Ghavami S, Filomeno KL, Jahan F,
            Kavosh MS, Davies JJ, Wigle JT and Dixon IM.
  TITLE     The Ski-Zeb2-Meox2 pathway provides a novel mechanism for
            regulation of the cardiac myofibroblast phenotype
  JOURNAL   J Cell Sci 127 (Pt 1), 40-49 (2014)
   PUBMED   24155330
  REMARK    GeneRIF: Ski modulates the cardiac myofibroblast phenotype and
            function through suppression of Zeb2 by upregulating the expression
            of Meox2.
REFERENCE   4  (bases 1 to 2247)
  AUTHORS   Rovelet-Lecrux A, Legallic S, Wallon D, Flaman JM, Martinaud O,
            Bombois S, Rollin-Sillaire A, Michon A, Le Ber I, Pariente J, Puel
            M, Paquet C, Croisile B, Thomas-Anterion C, Vercelletto M, Levy R,
            Frebourg T, Hannequin D and Campion D.
  CONSRTM   Investigators of the GMAJ project
  TITLE     A genome-wide study reveals rare CNVs exclusive to extreme
            phenotypes of Alzheimer disease
  JOURNAL   Eur J Hum Genet 20 (6), 613-617 (2012)
   PUBMED   22166940
REFERENCE   5  (bases 1 to 2247)
  AUTHORS   Douville JM, Cheung DY, Herbert KL, Moffatt T and Wigle JT.
  TITLE     Mechanisms of MEOX1 and MEOX2 regulation of the cyclin dependent
            kinase inhibitors p21 and p16 in vascular endothelial cells
  JOURNAL   PLoS One 6 (12), e29099 (2011)
   PUBMED   22206000
REFERENCE   6  (bases 1 to 2247)
  AUTHORS   Saito T, Itoh H, Yamashita J, Doi K, Chun TH, Tanaka T, Inoue M,
            Masatsugu K, Fukunaga Y, Sawada N, Sakaguchi S, Arai H, Tojo K,
            Tajima N, Hosoya T and Nakao K.
  TITLE     Angiotensin II suppresses growth arrest specific homeobox (Gax)
            expression via redox-sensitive mitogen-activated protein kinase
            (MAPK)
  JOURNAL   Regul Pept 127 (1-3), 159-167 (2005)
   PUBMED   15680482
  REMARK    GeneRIF: demonstrated that Ang II down-regulated Gax expression via
            redox-sensitive ERK1/2 activation in vascular smooth muscle cells
            [Gax]
REFERENCE   7  (bases 1 to 2247)
  AUTHORS   Mankoo BS, Skuntz S, Harrigan I, Grigorieva E, Candia A, Wright CV,
            Arnheiter H and Pachnis V.
  TITLE     The concerted action of Meox homeobox genes is required upstream of
            genetic pathways essential for the formation, patterning and
            differentiation of somites
  JOURNAL   Development 130 (19), 4655-4664 (2003)
   PUBMED   12925591
REFERENCE   8  (bases 1 to 2247)
  AUTHORS   Mankoo BS, Collins NS, Ashby P, Grigorieva E, Pevny LH, Candia A,
            Wright CV, Rigby PW and Pachnis V.
  TITLE     Mox2 is a component of the genetic hierarchy controlling limb
            muscle development
  JOURNAL   Nature 400 (6739), 69-73 (1999)
   PUBMED   10403250
REFERENCE   9  (bases 1 to 2247)
  AUTHORS   Quinn LM, Johnson BV, Nicholl J, Sutherland GR and Kalionis B.
  TITLE     Isolation and identification of homeobox genes from the human
            placenta including a novel member of the Distal-less family, DLX4
  JOURNAL   Gene 187 (1), 55-61 (1997)
   PUBMED   9073066
REFERENCE   10 (bases 1 to 2247)
  AUTHORS   Gorski DH, LePage DF, Patel CV, Copeland NG, Jenkins NA and Walsh
            K.
  TITLE     Molecular cloning of a diverged homeobox gene that is rapidly
            down-regulated during the G0/G1 transition in vascular smooth
            muscle cells
  JOURNAL   Mol Cell Biol 13 (6), 3722-3733 (1993)
   PUBMED   8098844
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JACYVU010000164.1.
            
            On Nov 26, 2020 this sequence version replaced NM_017149.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: Z17223.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA5756307, SAMEA5760384
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-706               JACYVU010000164.1  30144923-30145628
            707-879             JACYVU010000164.1  30194590-30194762
            880-2247            JACYVU010000164.1  30204263-30205630
FEATURES             Location/Qualifiers
     source          1..2247
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="6"
                     /map="6q21"
     gene            1..2247
                     /gene="Meox2"
                     /note="mesenchyme homeobox 2"
                     /db_xref="GeneID:29279"
                     /db_xref="RGD:3079"
     exon            1..706
                     /gene="Meox2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    178..180
                     /gene="Meox2"
                     /note="upstream in-frame stop codon"
     CDS             193..1104
                     /gene="Meox2"
                     /note="growth arrest-specific homeobox; mesenchyme homeo
                     box 2 (growth arrest-specific homeo box)"
                     /codon_start=1
                     /product="homeobox protein MOX-2"
                     /protein_id="NP_058845.2"
                     /db_xref="GeneID:29279"
                     /db_xref="RGD:3079"
                     /translation="
MEHPLFGCLRSPHATAQGLHPFSQSSLALHGRSDHMSYPELSTSSSSCIIAGYPNEEGMFASQHHRGHHHHHHHHHHHHQQQQHQALQSNWHLPQMSSPPSAARHSLCLQPDSGGPPELGSSPPVLCSNSSSLGSSTPTGAACAPGDYGRQALSPAEVEKRSGSKRKSDSSDSQEGNYKSEVNSKPRKERTAFTKEQIRELEAEFAHHNYLTRLRRYEIAVNLDLTERQVKVWFQNRRMKWKRVKGGQQGAAAREKELVNVKKGTLLPSELSGIGAATLQQTGDSLANDDSRDSDHSSEHAHL"
     misc_feature    379..765
                     /gene="Meox2"
                     /note="propagated from UniProtKB/Swiss-Prot (P39020.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    order(751..765,769..771,820..822,838..840,877..879,
                     883..888,895..900,904..912,916..921)
                     /gene="Meox2"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(757..759,766..768,886..888,895..900,907..909)
                     /gene="Meox2"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    760..918
                     /gene="Meox2"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    1027..1101
                     /gene="Meox2"
                     /note="propagated from UniProtKB/Swiss-Prot (P39020.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            707..879
                     /gene="Meox2"
                     /inference="alignment:Splign:2.1.0"
     exon            880..2247
                     /gene="Meox2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
agtgtttatacgtgcaggagactggccgctcggctcaggactgggattagcgggctctgctcaaacccgcgcggcttttacattaggagtgagtgggggagagtcctaggatttctagtgaaaagtgacagcgcttggtggactttgggaccttcgtgaagtcttctgcttggaagctgagacttgcatgccatggaacaccccctctttggctgcctgcgcagcccccacgccacagcgcaaggcttgcaccccttctcgcagtcttctctggccctccatggaagatctgaccacatgtcctaccccgaactctccacatcttcctcgtcttgcataatcgcgggataccccaatgaggagggcatgtttgccagccagcatcacagggggcaccaccaccaccaccaccaccaccatcaccaccaccagcagcagcagcaccaggctctgcaaagcaactggcacctcccgcagatgtcctccccgccaagcgcggcccggcacagcctttgcctgcagcctgattccggagggcccccggagctggggagcagccctccggtcctgtgctccaactcttctagcctgggctccagcaccccgaccggagccgcgtgcgcaccaggggattatggccgtcaagcgctgtcacccgcagaagtggagaagagaagtggcagcaaaagaaaaagcgacagttcagattcccaggaaggaaattacaagtcagaagtgaacagcaaacctaggaaggaaagaacagctttcaccaaagagcaaatcagagaacttgaggcagagttcgcccatcataactatctgaccagactgagaagatatgagatagcggtgaacctagacctcactgaaagacaggtgaaagtgtggttccagaacaggagaatgaagtggaagcgggtcaaggggggacaacaaggagctgcagcccgagaaaaggaactggtgaatgtgaaaaagggaacacttcttccatcagagctgtcaggaattggtgcagccaccctccagcagacaggggactcactagcaaatgacgacagtcgcgatagtgaccacagctctgagcacgcacacttatgatacatacagagaccagctccgttctcaggaaagcaccattgtgatggcaaatctcacccaaacatcgtttacatggcagatgactgtggcagtgttgcttaatataattaaacgcaggcatctcaagtctgtttctcatgattgatagaaggtttacactaagtgcctcttattgaagatgcttccacagtgaaattggagaaagtgaacatattctaaatatacttgttcctttatatgacagagagggagatgaatgtttgctttggcttgcactgaaaattaaattgctaccaagagcaaactcggtaagacattttgactcaagttgtctccagagtgaagatgttatagaaatgctttgaacattccagttgtaccaggtcatgtgtgtgacactgggcaggtatttgcttttgcttgcactgaaacttaaactgctatcaagttaacccatgaaatagtttatcttgaacagccacagtgcctgaaatcaccaagtggatataaaatgaactgaaattctgtatatattactcctaagtcattttcctgtcttcactaattttagcaaatgcattcatattagctgatgaaaataggctttcccgtggacaaatgcagccagcttcttgtatttttatacatttttttgtcagtcagagacaatcagtatgtgcttacttgtgttcaagtagaggaaatgcagtagagtctgataggacatattcttgtaccacagacaaaacaaatcttctgttgcattgactatcaactgctgcagatacattagagaacacacctagcccccctccagcctccctctgttatagctcgaagaacattaggatcataggcaagtaggttaccttgccaaatgagtcttgtgtggcagatgtctgattttgtatctttaaactgttaatgtgtatgggtctgcttcagtttaacagggaaaaagatttcttcctcattgtttatgatacaaaacccaagtgccaaacaaagctagttcttcaagggaatagatgagaaactgaatgtctgacaagtagactcagcgaaaatacattatttttcagaggctgtgtattcatgcagtacaagtccttgtattttgtaaaaaaaaaagttaaataaatg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]