LOCUS       NM_012794                584 bp    mRNA    linear   ROD 20-NOV-2023
DEFINITION  Rattus norvegicus glycosylation dependent cell adhesion molecule 1
            (Glycam1), mRNA.
ACCESSION   NM_012794
VERSION     NM_012794.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 584)
  AUTHORS   Dowbenko D, Watson SR and Lasky LA.
  TITLE     Cloning of a rat homologue of mouse GlyCAM 1 reveals conservation
            of structural domains
  JOURNAL   J Biol Chem 268 (19), 14399-14403 (1993)
   PUBMED   8100229
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JACYVU010000187.1.
            
            On Nov 26, 2020 this sequence version replaced NM_012794.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: L08100.1, BM390037.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA5760433, SAMN12840105
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-85                JACYVU010000187.1  21417263-21417347   c
            86-130              JACYVU010000187.1  21416485-21416529   c
            131-334             JACYVU010000187.1  21415575-21415778   c
            335-584             JACYVU010000187.1  21415087-21415336   c
FEATURES             Location/Qualifiers
     source          1..584
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="7"
                     /map="7q36"
     gene            1..584
                     /gene="Glycam1"
                     /note="glycosylation dependent cell adhesion molecule 1"
                     /db_xref="GeneID:25258"
                     /db_xref="RGD:2712"
     exon            1..85
                     /gene="Glycam1"
                     /inference="alignment:Splign:2.1.0"
     CDS             22..462
                     /gene="Glycam1"
                     /note="SGP50; glyCAM-1; sulfated 50 kDa glycoprotein;
                     endothelial ligand FOR L-selectin"
                     /codon_start=1
                     /product="glycosylation-dependent cell adhesion molecule 1
                     precursor"
                     /protein_id="NP_036926.2"
                     /db_xref="GeneID:25258"
                     /db_xref="RGD:2712"
                     /translation="

MKFFTVLLFASLAATSLAAVPGSKDELHLRTQPTDAIPASQFTPSSHISKESTSSKDLSKESSIFNEELVSEDNVGTESTKPQSQEAQDGLRSGSSQQEETTSAATSEGKLTMLSQAVQKELGKVIEGFISGVEDIISGASGTVRP"

     sig_peptide     22..78
                     /gene="Glycam1"
                     /note="/evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q04807.1)"
     mat_peptide     79..459
                     /gene="Glycam1"
                     /product="Glycosylation-dependent cell adhesion molecule
                     1. /id=PRO_0000025407"
                     /note="propagated from UniProtKB/Swiss-Prot (Q04807.1)"
     misc_feature    79..459
                     /gene="Glycam1"
                     /note="Glycosylation-dependent cell adhesion molecule 1
                     (GlyCAM-1); Region: GLYCAM-1; pfam05242"
                     /db_xref="CDD:368355"
     misc_feature    94..357
                     /gene="Glycam1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q04807.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    181..183
                     /gene="Glycam1"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P80195; propagated from
                     UniProtKB/Swiss-Prot (Q04807.1); phosphorylation site"
     misc_feature    196..198
                     /gene="Glycam1"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P80195; propagated from
                     UniProtKB/Swiss-Prot (Q04807.1); phosphorylation site"
     misc_feature    232..234
                     /gene="Glycam1"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P80195; propagated from
                     UniProtKB/Swiss-Prot (Q04807.1); phosphorylation site"
     exon            86..130
                     /gene="Glycam1"
                     /inference="alignment:Splign:2.1.0"
     exon            131..334
                     /gene="Glycam1"
                     /inference="alignment:Splign:2.1.0"
     exon            335..584
                     /gene="Glycam1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

ctgacctgttccagtgccaccatgaaattcttcactgtcctgctatttgccagccttgctgccacctctcttgctgccgtgcctgggtccaaagatgaactccacctgaggactcagcccacagatgccattccagcttcccagttcactccttccagccacatcagcaaggagagcacttccagtaaggacctttccaaggagtcttccatcttcaacgaagagctggtgtccgaagataatgtggggacagaatctaccaaaccacagagtcaagaggcccaggacgggctcaggagtgggtcatctcagcaggaagagaccacctcagctgcaacctcagagggaaaactgaccatgctgagccaggcagtgcagaaagaactgggtaaagtaattgaaggatttataagtggtgtggaagacataatctctggtgccagtggtaccgtgaggccctgaagacaaaaacgcctaaccgctaagtcccacgctaggtggcgccttcatcacccacattctgctcatctgaccaccacctcttggtctgccctttgatgtcttacattaaagtactgcaaccg

//