2024-05-06 09:35:37, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001401062 2498 bp mRNA linear ROD 31-DEC-2022 DEFINITION Rattus norvegicus janus kinase and microtubule interacting protein 1 (Jakmip1), transcript variant 5, mRNA. ACCESSION NM_001401062 VERSION NM_001401062.1 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 2498) AUTHORS Berg JM, Lee C, Chen L, Galvan L, Cepeda C, Chen JY, Penagarikano O, Stein JL, Li A, Oguro-Ando A, Miller JA, Vashisht AA, Starks ME, Kite EP, Tam E, Gdalyahu A, Al-Sharif NB, Burkett ZD, White SA, Fears SC, Levine MS, Wohlschlegel JA and Geschwind DH. TITLE JAKMIP1, a Novel Regulator of Neuronal Translation, Modulates Synaptic Function and Autistic-like Behaviors in Mouse JOURNAL Neuron 88 (6), 1173-1191 (2015) PUBMED 26627310 REFERENCE 2 (bases 1 to 2498) AUTHORS Vidal RL, Fuentes P, Valenzuela JI, Alvarado-Diaz CP, Ramirez OA, Kukuljan M and Couve A. TITLE RNA interference of Marlin-1/Jakmip1 results in abnormal morphogenesis and migration of cortical pyramidal neurons JOURNAL Mol Cell Neurosci 51 (1-2), 1-11 (2012) PUBMED 22828129 REMARK GeneRIF: RNA interference of Marlin-1 in vivo results in abnormal migration and abnormal morphology of newborn pyramidal neurons during the formation of the cortex. REFERENCE 3 (bases 1 to 2498) AUTHORS Vidal RL, Valenzuela JI, Lujan R and Couve A. TITLE Cellular and subcellular localization of Marlin-1 in the brain JOURNAL BMC Neurosci 10, 37 (2009) PUBMED 19386132 REMARK GeneRIF: Marlin-1 is enriched in restricted areas of the brain including olfactory bulb, cerebral cortex, hippocampus and cerebellum; it is abundant in dendrites and axons of hippocampal neurons, associated with microtubules at the ultrastructural level. Publication Status: Online-Only REFERENCE 4 (bases 1 to 2498) AUTHORS Vidal RL, Ramirez A, Castro M, Concha II and Couve A. TITLE Marlin-1 is expressed in testis and associates to the cytoskeleton and GABAB receptors JOURNAL J Cell Biochem 103 (3), 886-895 (2008) PUBMED 17668444 REMARK GeneRIF: Our findings demonstrate that Marlin-1 associates with a microtubule fraction and with GABA(B) receptors in testis suggesting that the set of protein interactions of Marlin-1 are conserved in different tissues. REFERENCE 5 (bases 1 to 2498) AUTHORS Nishimura Y, Martin CL, Vazquez-Lopez A, Spence SJ, Alvarez-Retuerto AI, Sigman M, Steindler C, Pellegrini S, Schanen NC, Warren ST and Geschwind DH. TITLE Genome-wide expression profiling of lymphoblastoid cell lines distinguishes different forms of autism and reveals shared pathways JOURNAL Hum Mol Genet 16 (14), 1682-1698 (2007) PUBMED 17519220 REFERENCE 6 (bases 1 to 2498) AUTHORS Vidal RL, Ramirez OA, Sandoval L, Koenig-Robert R, Hartel S and Couve A. TITLE Marlin-1 and conventional kinesin link GABAB receptors to the cytoskeleton and regulate receptor transport JOURNAL Mol Cell Neurosci 35 (3), 501-512 (2007) PUBMED 17532644 REFERENCE 7 (bases 1 to 2498) AUTHORS Couve A, Restituito S, Brandon JM, Charles KJ, Bawagan H, Freeman KB, Pangalos MN, Calver AR and Moss SJ. TITLE Marlin-1, a novel RNA-binding protein associates with GABA receptors JOURNAL J Biol Chem 279 (14), 13934-13943 (2004) PUBMED 14718537 REMARK GeneRIF: Marlin-1 functions to regulate the cellular levels of GABA(B) R2 subunits, which may have significant effects on the production of functional GABA(B) receptor heterodimers. COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JACYVU010000254.1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support SAMD00132261, SAMD00132263 [ECO:0000350] ##Evidence-Data-END## ##RefSeq-Attributes-START## inferred exon combination :: based on alignments, homology ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-248 JACYVU010000254.1 27467883-27468130 c 249-511 JACYVU010000254.1 27408432-27408694 c 512-1006 JACYVU010000254.1 27402371-27402865 c 1007-1216 JACYVU010000254.1 27392753-27392962 c 1217-1336 JACYVU010000254.1 27391706-27391825 c 1337-1483 JACYVU010000254.1 27389166-27389312 c 1484-1624 JACYVU010000254.1 27388347-27388487 c 1625-1684 JACYVU010000254.1 27386877-27386936 c 1685-1813 JACYVU010000254.1 27376683-27376811 c 1814-1942 JACYVU010000254.1 27375213-27375341 c 1943-2026 JACYVU010000254.1 27373168-27373251 c 2027-2089 JACYVU010000254.1 27371977-27372039 c 2090-2498 JACYVU010000254.1 27370091-27370499 c FEATURES Location/Qualifiers source 1..2498 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="14" /map="14q21" gene 1..2498 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /note="janus kinase and microtubule interacting protein 1" /db_xref="GeneID:305434" /db_xref="RGD:1562401" exon 1..248 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /inference="alignment:Splign:2.1.0" exon 249..511 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /inference="alignment:Splign:2.1.0" misc_feature 344..346 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /note="upstream in-frame stop codon" CDS 383..2263 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /note="isoform 5 is encoded by transcript variant 5; multiple alpha helices and RNA-linker protein 1; multiple coiled-coil GABABR1-binding protein" /codon_start=1 /product="janus kinase and microtubule-interacting protein 1 isoform 5" /protein_id="NP_001387991.1" /db_xref="GeneID:305434" /db_xref="RGD:1562401" /translation="
MSKKGRSKGEKPETETDSVQMANEELRAKLTNIQIEFQQEKSKVGKLRERLQEAKLEREQEQRRHTAYISELKAKLHEEKTKELQALREALIRQHEQEAARTAKIKEGELQRLQATLNVLRDGAADKVKTALLADAREEARRTFDGERQRLQQEILELKAARKQAEEALSNCMQADKAKAADLRAAYQAHQDEVHRIKRECERDIRRLMDEIKGKERVILALEKELGVQAGQTQRLLLQKEALDEQLVQVKEAERHHSSPKRELPPGIGDMAELMGGQDQHMDERDVRRFQLKIAELNSVIRKLEDRNTLLADERNELLKRSRETEVQLKPLVEKNKRMNKKNEDLLHSIQRMEEKLKSLTRENVEMKEKLSAQASLKRHTSLNDLSLTRDEQEIEFLRLQVLEQQHVIDDLSLERERLLRSKRHRGKSLKPPKKHVVETFFGFDEESVDSETLSETSYNTDRTDRTPATPEEDLDETTTREEADLRFCQLTREYQALQRAYALLQEQVGGTLDAEREARTREQLQADLLRCQAKIEDLEKLLVEKGQDAAWVEEKQVLMRTNQDLLEKIYRLEMEENQLKSEMQDAKDQNELLEFRVLELEVRDSICCKLSNGADILFEPKLKFV"
misc_feature 383..1477 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /note="propagated from UniProtKB/Swiss-Prot (Q3SWS9.1); Region: Mediates association with microtubules. /evidence=ECO:0000250" misc_feature 383..457 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /note="propagated from UniProtKB/Swiss-Prot (Q3SWS9.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature <398..1471 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /note="chromosome segregation protein SMC, primarily archaeal type; Region: SMC_prok_A; TIGR02169" /db_xref="CDD:274009" misc_feature 1475..2260 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /note="propagated from UniProtKB/Swiss-Prot (Q3SWS9.1); Region: Mediates interaction with TYK2 and GABBR1. /evidence=ECO:0000250" misc_feature 1526..1528 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:Q96N16; propagated from UniProtKB/Swiss-Prot (Q3SWS9.1); phosphorylation site" misc_feature 1625..2194 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /note="JAKMIP CC3 domain; Region: JAKMIP_CC3; pfam16034" /db_xref="CDD:435088" misc_feature 1736..1825 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /note="propagated from UniProtKB/Swiss-Prot (Q3SWS9.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 1790..1792 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /note="Phosphothreonine. /evidence=ECO:0000250|UniProtKB:Q96N16; propagated from UniProtKB/Swiss-Prot (Q3SWS9.1); phosphorylation site" exon 512..1006 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /inference="alignment:Splign:2.1.0" exon 1007..1216 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /inference="alignment:Splign:2.1.0" exon 1217..1336 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /inference="alignment:Splign:2.1.0" exon 1337..1483 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /inference="alignment:Splign:2.1.0" exon 1484..1624 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /inference="alignment:Splign:2.1.0" exon 1625..1684 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /inference="alignment:Splign:2.1.0" exon 1685..1813 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /inference="alignment:Splign:2.1.0" exon 1814..1942 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /inference="alignment:Splign:2.1.0" exon 1943..2026 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /inference="alignment:Splign:2.1.0" exon 2027..2089 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /inference="alignment:Splign:2.1.0" exon 2090..2498 /gene="Jakmip1" /gene_synonym="Marlin-1; Marlin1" /inference="alignment:Splign:2.1.0" ORIGIN
agccgctagcgtgcggcgcctgtccccgccgttcccgcatcgtgcacgggttctccgcgggccgagcctcctcggctacggtccaggttttctttattttcattttttgcatgcattcattttctgttctatcttgtcccttttaaggcagcggtgactgggacagcagcgtaggcgcgcgcggggaggaggcggctggagaatgcggctcccggctgctgcccggtttgggtcggagcgtcaagcagactctccagtgatggtgtgcacagaggacgagcggaggcctgcacgactgcttagcacagctgagctggtagctgtgcttgccggtgggcaggcgtgaacctcaggacctcagcgtctcactccaagaggaaacatgtctaaaaagggccgcagcaagggtgagaagcccgagacagagacagactctgtacagatggccaatgaagagctacgggccaagctgacgaacatccagatcgagttccagcaggagaagagcaaggtggggaagctgcgggagcgtctgcaggaggccaagctggaacgggagcaggagcagcgtcgccacacggcctacatctcagaactcaaggccaagctgcacgaagagaagacgaaggaactgcaggcgctgcgcgaggcgctcatccggcagcacgagcaggaggcagcgcggaccgccaagatcaaggaaggcgagctgcagcgactgcaggccacgctgaatgtgctgcgcgatggcgccgcggacaaagtcaagactgcattgctggccgacgcgcgcgaggaggcgcgcaggacctttgatggcgagcgccagaggctgcagcaggagattctggaactgaaggctgcgcgcaaacaggcagaagaggcactcagcaactgcatgcaggcagacaaggccaaagccgcggacctgcgcgctgcgtaccaggcgcaccaggatgaggtgcaccgcatcaagcgggagtgtgaacgtgacatccgcagactgatggacgagatcaaaggaaaggaacgcgtgatcctggccctggagaaggagcttggtgtgcaggccgggcagacccagcggctgctattacagaaggaggctctggatgagcagctggtccaggtcaaggaggccgaacgccaccacagcagcccaaagagggagcttcctccaggcattggtgacatggctgagcttatgggtggccaggatcagcatatggacgagcgagatgtgaggcgatttcagctgaagattgccgaactgaattcagtgattcggaagctggaggacaggaacaccctgctggctgatgagaggaacgaactgctgaagcgctctcgggagacggaggtgcagctgaagccgctggtggagaagaacaaacgcatgaataaaaagaacgaggatctgctgcacagcatccaaaggatggaggagaaactcaagagcctcacgagggaaaacgtggagatgaaagaaaagctgtctgcccaggcctcactaaagcgacacacatccctgaatgacctcagtctgaccagggacgagcaggagatagagttcctgaggctgcaggtgctggaacagcagcatgtcattgatgacctctctctggaaagagaacgcctgctgcgctccaagaggcatcgagggaagagcctgaaaccccccaagaagcatgttgtggagacattttttggatttgatgaggagtctgtggactctgaaacattgtcagagacgtcctacaacacagacaggacagaccggaccccagccacgcctgaagaggacttagatgagaccacaaccagagaagaggctgacctgaggttctgccagctgaccagggagtaccaggctctgcagagggcttatgccctgcttcaggagcaggttggggggacgctggatgctgagagggaggctcggactcgggagcaacttcaggctgacctgctgagatgccaggccaaaattgaggacttagagaagctgctggttgagaagggacaggatgctgcgtgggtagaggagaagcaggtactcatgaggacaaaccaggacctgctggagaagatttacaggctggagatggaggagaaccagctaaagagtgaaatgcaagacgccaaggaccagaacgagctgttagaattcagagtgctagaactcgaagtaagagactctatctgttgtaagctctcaaatggagcagacattctctttgagcccaaactgaaattcgtgtaaagctctctgctatttccaagcatgcgtgaagggacgcgcgttaccgtttctctccttccttcctccgttcttttcctcttcgtctttttaaaaagatctgtatgttcggggtaacttcactgccttaacatgtcctggggaggatgctcgcgacgcctgtggacctgtaccagagcaatcgacttattgcctaccgcttgttttgcacttaataaaataagttgtttttgcaata
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]