GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2025-12-10 11:25:48, GGRNA : RefSeq release 232 (Sep, 2025)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Mus musculus microRNA 375 (Mir375), microRNA. (64 bp)
L., Krutzfeldt,J., Kuwajima,S., Ma,X., Macdonald,P.E., Pfeffer,S., Tuschl,T., Rajewsky,N., Rorsman,P. and Stoffel,M. TITLE A pancreatic islet-specific microRNA regulates insulin secretion JOURNAL Nature 432 (7014), 226-230 (2004) PUBMED 15538371 ccccgcgacgagcccctcgcacaaaccggacctgagcgttttgttcgttcggctcgcgtgaggc
position 40
Synonym: mir-375; Mirn375; mmu-mir-375
NR_029876.1 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
Mus musculus predicted gene, 34939 (Gm34939), long non-coding RNA. (1824 bp)
ctacgggctagagggggcgactagcgggaaaggcgtgctgaccactccctcccgccttcacgggccaggagggagcaccatagagaagcggtgtgcggataaagaggtgccgggagcgagcgcctccacgcggttggaggacggtgccttgcagagagcccagcccatccggctggcggctggagtgatgcttcaccttggcccagtgcatttacctctccaaagcattctggttgccttgcttttcgttctcctactgctcagactccgggtactaaagaggaaaacgtgctgtttgttcgttcgggaaaagtagaactcgaaggagatcaatgtcgtggcaaagacaaatcagcaagagaaaacccatgccgggccgtggtggcgcacgcctttaatcccagcacttgggaggcagaggcaggcggatttctgagttcgaggccagcctggtctacagagtgagttccaggacagccagggatacacagagaaggctcgggacccttcacctcagacgtttaacttaagattttgatgcgttttttcccgtgacttttctccaaagagtcctggatatttgttgccatagataactgc...
position 1344
NR_168656.1 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : https://ggrna.dbcls.jp/en/mm/seq%3aUUUGUUCGUUCGG
lang : en | div : | spe : mm | query_string : seq:UUUGUUCGUUCGG | format : html | download :

0.000 | 0.000 | search_start;
0.075 | 0.075 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TTTGTTCGTTCGG)?source=Mus musculus (house mouse)?to=0&format=json
0.085 | 0.010 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TTTGTTCGTTCGG)?source=Mus musculus (house mouse)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.086 | 0.000 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]