2025-07-13 04:46:09, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XR_374759 550 bp RNA linear ROD 07-FEB-2024 DEFINITION PREDICTED: Mus musculus predicted gene 13715 (Gm13715), transcript variant X2, ncRNA. ACCESSION XR_374759 VERSION XR_374759.2 DBLINK BioProject: PRJNA169 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_000068.8) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced XR_374759.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_000001635.27-RS_2024_02 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Best-placed RefSeq; Gnomon; RefSeqFE; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 02/01/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..550 /organism="Mus musculus" /mol_type="transcribed RNA" /strain="C57BL/6J" /db_xref="taxon:10090" /chromosome="2" gene 1..550 /gene="Gm13715" /note="predicted gene 13715; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 7 long SRA reads, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 5 samples with support for all annotated introns" /db_xref="GeneID:102640825" /db_xref="MGI:MGI:3650277" ncRNA 1..550 /ncRNA_class="lncRNA" /gene="Gm13715" /product="predicted gene 13715, transcript variant X2" /db_xref="GeneID:102640825" /db_xref="MGI:MGI:3650277" ORIGIN
aaaagaatgcttttggccaaatcttccctggagtcacttacactatcttgcaaagcccaggcatcgatgagacttagaaatgttcccagggacacgaaactgagttgctccatcttcaagcagaatggagagtaaagggttgcaagaggtgagacagttgagacccagagaggtatgacagcttcctgaagtcgtcatggaatatgtatcacggagatgggtatgcagctgaggtagagctttctttgtgaaaggttgactgttaaagaagacttttgcaaggatggtgtgaccatctagcatgggacctactgatggtcagggagtggtcatatgttcctgagcgaaagcaccataggcagaaagactgggaccctcaagacctgagatatggcctctgagatggtgcagctgcaggagaggttcctcttgatcactgtgctgactgacagaaggttgagatgatccatgatgcctctgctgggctataaacacggttccttgaagtacatgattgtgtttggaaataaagctttctgatgcaaattaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]