2025-07-13 04:29:20, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NR_186735 2112 bp RNA linear ROD 05-JUL-2023 DEFINITION Mus musculus zinc finger protein 410 (Zfp410), transcript variant 14, non-coding RNA. ACCESSION NR_186735 XR_004937528 VERSION NR_186735.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 2112) AUTHORS Vinjamur DS, Yao Q, Cole MA, McGuckin C, Ren C, Zeng J, Hossain M, Luk K, Wolfe SA, Pinello L and Bauer DE. TITLE ZNF410 represses fetal globin by singular control of CHD4 JOURNAL Nat Genet 53 (5), 719-728 (2021) PUBMED 33859416 REFERENCE 2 (bases 1 to 2112) AUTHORS Campbell GR, Baudhuin A, Vranizan K and Ngai J. TITLE Transcription factors expressed in olfactory bulb local progenitor cells revealed by genome-wide transcriptome profiling JOURNAL Mol Cell Neurosci 46 (2), 548-561 (2011) PUBMED 21194568 REFERENCE 3 (bases 1 to 2112) AUTHORS Guo G, Huss M, Tong GQ, Wang C, Li Sun L, Clarke ND and Robson P. TITLE Resolution of cell fate decisions revealed by single-cell gene expression analysis from zygote to blastocyst JOURNAL Dev Cell 18 (4), 675-685 (2010) PUBMED 20412781 REFERENCE 4 (bases 1 to 2112) AUTHORS Yokoyama S, Ito Y, Ueno-Kudoh H, Shimizu H, Uchibe K, Albini S, Mitsuoka K, Miyaki S, Kiso M, Nagai A, Hikata T, Osada T, Fukuda N, Yamashita S, Harada D, Mezzano V, Kasai M, Puri PL, Hayashizaki Y, Okado H, Hashimoto M and Asahara H. TITLE A systems approach reveals that the myogenesis genome network is regulated by the transcriptional repressor RP58 JOURNAL Dev Cell 17 (6), 836-848 (2009) PUBMED 20059953 REFERENCE 5 (bases 1 to 2112) AUTHORS Pritsker M, Doniger TT, Kramer LC, Westcot SE and Lemischka IR. TITLE Diversification of stem cell molecular repertoire by alternative splicing JOURNAL Proc Natl Acad Sci U S A 102 (40), 14290-14295 (2005) PUBMED 16183747 REFERENCE 6 (bases 1 to 2112) AUTHORS Stryke D, Kawamoto M, Huang CC, Johns SJ, King LA, Harper CA, Meng EC, Lee RE, Yee A, L'Italien L, Chuang PT, Young SG, Skarnes WC, Babbitt PC and Ferrin TE. TITLE BayGenomics: a resource of insertional mutations in mouse embryonic stem cells JOURNAL Nucleic Acids Res 31 (1), 278-281 (2003) PUBMED 12520002 REFERENCE 7 (bases 1 to 2112) AUTHORS Benanti JA, Williams DK, Robinson KL, Ozer HL and Galloway DA. TITLE Induction of extracellular matrix-remodeling genes by the senescence-associated protein APA-1 JOURNAL Mol Cell Biol 22 (21), 7385-7397 (2002) PUBMED 12370286 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC159649.3. On Jul 5, 2023 this sequence version replaced XR_004937528.1. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMN00849383, SAMN00849388 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-57 AC159649.3 168334-168390 58-237 AC159649.3 173028-173207 238-373 AC159649.3 174100-174235 374-592 AC159649.3 176787-177005 593-784 AC159649.3 178495-178686 785-910 AC159649.3 188832-188957 911-1051 AC159649.3 189858-189998 1052-1254 AC159649.3 190267-190469 1255-1382 AC159649.3 191318-191445 1383-2112 AC159649.3 194211-194940 FEATURES Location/Qualifiers source 1..2112 /organism="Mus musculus" /mol_type="transcribed RNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="12" /map="12 39.15 cM" gene 1..2112 /gene="Zfp410" /gene_synonym="Apa1; D12Ertd748e; Znf410" /note="zinc finger protein 410" /db_xref="GeneID:52708" /db_xref="MGI:MGI:1289280" misc_RNA 1..2112 /gene="Zfp410" /gene_synonym="Apa1; D12Ertd748e; Znf410" /product="zinc finger protein 410, transcript variant 14" /db_xref="GeneID:52708" /db_xref="MGI:MGI:1289280" exon 1..57 /gene="Zfp410" /gene_synonym="Apa1; D12Ertd748e; Znf410" /inference="alignment:Splign:2.1.0" exon 58..237 /gene="Zfp410" /gene_synonym="Apa1; D12Ertd748e; Znf410" /inference="alignment:Splign:2.1.0" misc_feature 205..1074 /gene="Zfp410" /gene_synonym="Apa1; D12Ertd748e; Znf410" /inference="COORDINATES: alignment:Blast2seq::RefSeq|NM_144833.4" /note="primary ORF has stop codon >50 nucleotides from the terminal splice site; nonsense-mediated decay (NMD) candidate" exon 238..373 /gene="Zfp410" /gene_synonym="Apa1; D12Ertd748e; Znf410" /inference="alignment:Splign:2.1.0" exon 374..592 /gene="Zfp410" /gene_synonym="Apa1; D12Ertd748e; Znf410" /inference="alignment:Splign:2.1.0" exon 593..784 /gene="Zfp410" /gene_synonym="Apa1; D12Ertd748e; Znf410" /inference="alignment:Splign:2.1.0" exon 785..910 /gene="Zfp410" /gene_synonym="Apa1; D12Ertd748e; Znf410" /inference="alignment:Splign:2.1.0" exon 911..1051 /gene="Zfp410" /gene_synonym="Apa1; D12Ertd748e; Znf410" /inference="alignment:Splign:2.1.0" exon 1052..1254 /gene="Zfp410" /gene_synonym="Apa1; D12Ertd748e; Znf410" /inference="alignment:Splign:2.1.0" exon 1255..1382 /gene="Zfp410" /gene_synonym="Apa1; D12Ertd748e; Znf410" /inference="alignment:Splign:2.1.0" exon 1383..2112 /gene="Zfp410" /gene_synonym="Apa1; D12Ertd748e; Znf410" /inference="alignment:Splign:2.1.0" ORIGIN
gtgtgtggacgggattcggggctgactgacggacggacggctgcccgagactggaaggttaaattgattaccaacctagttcagcatcttacaggaaaagtgtaatgctttttaaagggatatgaatataacaggaaggtgtcattgactgaattagacttgaacctgtccctgatcagctacaggatttcagaagctgaatcaatgttatcagatgagttagaatccaaaccagagctcctggttcagtttgttcagaatacctccatccccctgggacaagggctagtagaatcagaagctaaagacattacttgcttatccctccttccagtgaccgaggcctcagaatgcagccgactaatgttaccagatgaaactccaaatcatgctaattcctccaaggaggtcccttcttcagctgttttgaggagccttcaggtgaatgtgggcccagacggagaagagacaagggctcagactgtacagaagtccccagagttcctgaccacaccagagtcgcctagcttgttgcaagatctacagccaagtgatagcacttccttcattcttctgaacctaacgagagcagggctgggctcttcagctgagcactttgtgtttgttcaggatgagacagaggactcaggggctgacttcctctctgctgagagcacagacagcagtatcccatggttcctccgggttcaggaactggcccatgacagtctgattgcggctactcgtgcacagctggccaagaatgcaaaaactggcagcaatggtgagaagcctcatcagtgccaggtctgtgggaagaccttctctcagagtgggagtaggaatgtgcatatgagaaagcatcacttgcagctggggacaactgggagtcaagaacaggatcaaaccgccgagccactaatgggcagtagtttgcttgaagacgcttcagttcccaataaaaacctggtgtctatgaattcccagtccagccttggtggagagtccttgaatctatcaaataccaattctatccttggagttgatgatgttatggaagagcttaacttttaaaacatttaaacagagcataaccaggttttacagaggagatacaaagcaatttctccataccttcaaaagccatgtcttctggagaacagaaagggctctctaggaaacagttgctcctctggtatagaaatttcacccagcttacacaggccaggccctcttctctgaaaatcttaccagaggtgcttactgaaagagcctcacggcccctgtcttctgtgcctgatgtgacacatcacttggtgaccatgcagtcagggaggcagtcctatgaagtttctgtcttaactgcggtaaatccgcaggagttactaaaccaaggagatttaactgaaagacagacatgagtgtgctgactcctggagatgctgttgtctgatcccagagtgcatgatgggaacagatccaaaggctcataatctgccagaactaaaaggagtctgaaggaccaagaccttgccttgcctctgttgtctgagggctctcttcaacctccaccgatgcagtccaagagtgaagcagtggccgtgggctggatacctgtgccgcctctctcctcagcgcagcgtttgggagtagacttgccaagagcaggtttaattatgtgttggctgaagattttcattgtgactgtcaaggttttcctttgaagagttttcaccctaggcccagctatctttccatatggttgaattatgtcctgcttccaaccagaacactgagttttcaagatgccttgttgctttgaagaagggaggggtgccaattacactgtagcattgcactctccctttagcaacctgagtaagacttagcctttgggctgtaaaaattaaattacttgaatctctccttggcccaggctgaggtaccaacttaccctgtacactttgacttggtcatttttttgttttgtttatgggacttaaaatagcatgttatcagggggttttatttgttgttgttgtttttttttaagttaaaaaccacatgatctagagtttgttttccttttaaataaacaaaacaacctagtca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]