GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-19 10:00:25, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       NR_176979               2949 bp    RNA     linear   ROD 03-AUG-2022
DEFINITION  Mus musculus RAD52 homolog, DNA repair protein (Rad52), transcript
            variant 18, non-coding RNA.
ACCESSION   NR_176979
VERSION     NR_176979.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 2949)
  AUTHORS   Xu Y, Zhou H, Post G, Zan H and Casali P.
  TITLE     Rad52 mediates class-switch DNA recombination to IgD
  JOURNAL   Nat Commun 13 (1), 980 (2022)
   PUBMED   35190531
  REMARK    GeneRIF: Rad52 mediates class-switch DNA recombination to IgD.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 2949)
  AUTHORS   Wang J, Oh YT, Li Z, Dou J, Tang S, Wang X, Wang H, Takeda S and
            Wang Y.
  TITLE     RAD52 Adjusts Repair of Single-Strand Breaks via Reducing
            DNA-Damage-Promoted XRCC1/LIG3alpha Co-localization
  JOURNAL   Cell Rep 34 (2), 108625 (2021)
   PUBMED   33440161
  REMARK    GeneRIF: RAD52 Adjusts Repair of Single-Strand Breaks via Reducing
            DNA-Damage-Promoted XRCC1/LIG3alpha Co-localization.
REFERENCE   3  (bases 1 to 2949)
  AUTHORS   Wang H, Li S, Oaks J, Ren J, Li L and Wu X.
  TITLE     The concerted roles of FANCM and Rad52 in the protection of common
            fragile sites
  JOURNAL   Nat Commun 9 (1), 2791 (2018)
   PUBMED   30022024
  REMARK    GeneRIF: Suppression of Rad52 expression in combination with FANCM
            knockout drastically reduces cell and tumor growth, suggesting a
            synthetic lethality interaction between these two genes.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 2949)
  AUTHORS   Sullivan-Reed K, Bolton-Gillespie E, Dasgupta Y, Langer S,
            Siciliano M, Nieborowska-Skorska M, Hanamshet K, Belyaeva EA,
            Bernhardy AJ, Lee J, Moore M, Zhao H, Valent P, Matlawska-Wasowska
            K, Muschen M, Bhatia S, Bhatia R, Johnson N, Wasik MA, Mazin AV and
            Skorski T.
  TITLE     Simultaneous Targeting of PARP1 and RAD52 Triggers Dual Synthetic
            Lethality in BRCA-Deficient Tumor Cells
  JOURNAL   Cell Rep 23 (11), 3127-3136 (2018)
   PUBMED   29898385
REFERENCE   5  (bases 1 to 2949)
  AUTHORS   Lieberman R, Pan J, Zhang Q and You M.
  TITLE     Rad52 deficiency decreases development of lung squamous cell
            carcinomas by enhancing immuno-surveillance
  JOURNAL   Oncotarget 8 (21), 34032-34044 (2017)
   PUBMED   28415565
  REMARK    GeneRIF: Results demonstrate that Rad52 depletion increased cell
            death, decreased myeloid cell frequency, and augmented the activity
            of CD8+ T cells and NK effectors that ultimately led to reduced
            tumor growth. These data provide support for the notion of RAD52 as
            a potential oncogene, implicating a major role for the combined
            processes of recombinational repair and host immunity in
            determining risk for Squamous Cell.
REFERENCE   6  (bases 1 to 2949)
  AUTHORS   Klein HL.
  TITLE     Genetic control of intrachromosomal recombination
  JOURNAL   Bioessays 17 (2), 147-159 (1995)
   PUBMED   7748165
  REMARK    Review article
REFERENCE   7  (bases 1 to 2949)
  AUTHORS   Shen Z, Denison K, Lobb R, Gatewood JM and Chen DJ.
  TITLE     The human and mouse homologs of the yeast RAD52 gene: cDNA cloning,
            sequence analysis, assignment to human chromosome 12p12.2-p13, and
            mRNA expression in mouse tissues
  JOURNAL   Genomics 25 (1), 199-206 (1995)
   PUBMED   7774919
REFERENCE   8  (bases 1 to 2949)
  AUTHORS   Li X, Rosahl TW, Sudhof TC and Francke U.
  TITLE     Mapping of synapsin II (SYN2) genes to human chromosome 3p and
            mouse chromosome 6 band F
  JOURNAL   Cytogenet Cell Genet 71 (3), 301-305 (1995)
   PUBMED   7587399
REFERENCE   9  (bases 1 to 2949)
  AUTHORS   Muris DF, Bezzubova O, Buerstedde JM, Vreeken K, Balajee AS, Osgood
            CJ, Troelstra C, Hoeijmakers JH, Ostermann K, Schmidt H et al.
  TITLE     Cloning of human and mouse genes homologous to RAD52, a yeast gene
            involved in DNA repair and recombination
  JOURNAL   Mutat Res 315 (3), 295-305 (1994)
   PUBMED   7526206
REFERENCE   10 (bases 1 to 2949)
  AUTHORS   Kramerov,D.A., Tillib,S.V., Ryskov,A.P. and Georgiev,G.P.
  TITLE     Nucleotide sequence of small polyadenylated B2 RNA
  JOURNAL   Nucleic Acids Res 13 (18), 6423-6437 (1985)
   PUBMED   2414725
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC117667.9.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1660811.29609.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849375, SAMN00849382
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1483              AC117667.9         44548-46030         c
            1484-1577           AC117667.9         39859-39952         c
            1578-1679           AC117667.9         37897-37998         c
            1680-1747           AC117667.9         36763-36830         c
            1748-1866           AC117667.9         35648-35766         c
            1867-1942           AC117667.9         34958-35033         c
            1943-2142           AC117667.9         32214-32413         c
            2143-2294           AC117667.9         31923-32074         c
            2295-2375           AC117667.9         30810-30890         c
            2376-2597           AC117667.9         29972-30193         c
            2598-2949           AC117667.9         28177-28528         c
FEATURES             Location/Qualifiers
     source          1..2949
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="6"
                     /map="6 56.86 cM"
     gene            1..2949
                     /gene="Rad52"
                     /gene_synonym="Rad52yh"
                     /note="RAD52 homolog, DNA repair protein"
                     /db_xref="GeneID:19365"
                     /db_xref="MGI:MGI:101949"
     misc_RNA        1..2949
                     /gene="Rad52"
                     /gene_synonym="Rad52yh"
                     /product="RAD52 homolog, DNA repair protein, transcript
                     variant 18"
                     /db_xref="GeneID:19365"
                     /db_xref="MGI:MGI:101949"
     exon            1..1483
                     /gene="Rad52"
                     /gene_synonym="Rad52yh"
                     /inference="alignment:Splign:2.1.0"
     exon            1484..1577
                     /gene="Rad52"
                     /gene_synonym="Rad52yh"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    1491..1733
                     /gene="Rad52"
                     /gene_synonym="Rad52yh"
                     /inference="COORDINATES:
                     alignment:Blast2seq::RefSeq|NM_001166381.1"
                     /note="primary ORF has stop codon >50 nucleotides from the
                     terminal splice site; nonsense-mediated decay (NMD)
                     candidate"
     exon            1578..1679
                     /gene="Rad52"
                     /gene_synonym="Rad52yh"
                     /inference="alignment:Splign:2.1.0"
     exon            1680..1747
                     /gene="Rad52"
                     /gene_synonym="Rad52yh"
                     /inference="alignment:Splign:2.1.0"
     exon            1748..1866
                     /gene="Rad52"
                     /gene_synonym="Rad52yh"
                     /inference="alignment:Splign:2.1.0"
     exon            1867..1942
                     /gene="Rad52"
                     /gene_synonym="Rad52yh"
                     /inference="alignment:Splign:2.1.0"
     exon            1943..2142
                     /gene="Rad52"
                     /gene_synonym="Rad52yh"
                     /inference="alignment:Splign:2.1.0"
     exon            2143..2294
                     /gene="Rad52"
                     /gene_synonym="Rad52yh"
                     /inference="alignment:Splign:2.1.0"
     exon            2295..2375
                     /gene="Rad52"
                     /gene_synonym="Rad52yh"
                     /inference="alignment:Splign:2.1.0"
     exon            2376..2597
                     /gene="Rad52"
                     /gene_synonym="Rad52yh"
                     /inference="alignment:Splign:2.1.0"
     exon            2598..2949
                     /gene="Rad52"
                     /gene_synonym="Rad52yh"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
tagctttggctgtcccagaactgagagatctgcttgcctctgcctctgcctcccaagtgctggaattaaagtcatgggccgccttgaccagctctgggtgacagtttcacctaaaatatagatggatgctttgatgaaattataagaccaaacagacaagatatgttcattattttcaaaatctaagtacagaacggagccgacttcatttctcatgtatgtagacagggtttgtggtgatagcaatttgaatatgaagcaagattgccatccatgtcccaccccagcactcccccacaggaacaacctcaaatgtgagatacaccgaccaaagtcacctgggaagggaaaggagttcctgccacctgccaccagaaggctgtgggctggcctctttctggacaaggccttccttctgtgcagttttggtttattctgatagaacactggacaatatctgatctggactgagaaggcagggagtgggtacacagtgagttctagggcagtctgaatgagaccccaactagaacaaacaaatgtcccgtatgttaatcccaaagatgggaggagaaggaccgttgactcacatcatcatgggcaagttaattaaagcaagcagttagtgaaaataagccttttctatttgtgtacattggctgcctccacttacggcacggttggagagatcagcattggatatgaggaagctaagactttcatagctcaagggtaggaggtttccaagtgtggggattggcaggcaaaataggcagagttacaggtgcagaacaaagcataacaagtagttctaaagacctcctgaaacaaagacatggttgcaaggtgggcataacaaggtagtcctaataactggtatccatagcgacccctttgcaacaatggtgggttgcaagatagttattaactttttgaaacaaagacatgattaccattcctggaacaggcttacagaaccatttgtagttaaggttgtaggtgggacatagcccagtccttgagaaacaggtttaatcatgaacaggaatgaggctagtttgtctttacaataagatggctttaaagcccaagatggaggcaggctgggtcttcacatatctgccatgaataatgggagttggtggcataaccacttccgtgattcagtagcaaaaagtctagcatggaatttttttaaaatagcttttaattattttctgtgggactcgcttgggtggtatgtgggggtcagaggacagtgtgcagaagcctctctttattccaccatgggtccccaggattgaactctgacttggtggcaagtacccttaccttctgagctatcttgctggcccaggtctttttctttccctgtgatacatacccatgcctcaccctttctttccattgtcctagttgatccttttctcactcctctctgtgctggtgtgaatcatcactgttaaacacggcctgctggggaggtcaacatggctgggcctgaagaagcagtccacagagggtgtgacaaccatcctccctttgttggtgggaagtctgtgctcctctttggacagagccagtatacagcggatgaataccaggccatccagaaagctctgagacagagactgggtccagagtacattagcagccgcatggctggaggaggtcagaagattttgttgacctcaacaatggcaagttctacgtgggagtctgtgcatttgtaaaggtgcagttaaaggatggttcctatcatgaggacgtgggctatggagttagtgagggcctccgttcaaaggccttgtcactggagaaggccaggaaggaggctgtgactgatgggctgaagcgagcactcaggagttttgggaatgcacttggaaactgtattctggacaaagactatctgaggtcactaaataagcttccacgacagctccctcttgatgtggatttaactaaaacaaagagagaagattttgaaccatctgtagaacaggcaagatacaacagctgccgacagaatgaagcattgggactccccaaaccacaggaagtgacttccccttgcagatcaagccccccacatgactcgaacattaagcttcagggggctaaggacatcagcagctcctgcagtctggccgccaccttggagagtgacgccactcaccagaggaagctccggaagctccggcagaagcagctccagcagcagttccgggaacagatggagactcgccggcagagccatgcacctgccgaagaggtggcagccaagcatgcggcagtacttccagcccctccaaaacacagcacccctgtaactgcagcctcagaactcctccaggagaaagtcgtctttccagataaccttgaagagaaccttgaaatgtgggaccttactccagacttagaggacatcattaagcccttgtgtagagcagaaccagcccaaacttctgccactcgaaccttcaacaaccaggacagcgtcccacatatccattgccatcagaaaccacaagaaaagcctggacctgggcacctgcagacctgcaacaccaaccagcatgttctaggtagcagagaagactctgaacctcataggaagagccaggacctgaagaaaaggaaactagatccatcctgagactcaagatgtcactagaccgtcacaaaaggactttggaaaactgcagtttggtcacaaaattgttccaccttggctcatgctgaactctttagaggactatagaggaagctaactacttaaaaaggttgtcataccccatgatgggaaggaggccaacagataaactttgttcagtattactcactcctaagctgattctaggaccttgcaggctgcctttcatttaacgatgttgcccaccaagccccagcatgactgttacctacattaaattatgtgtgacctca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]