2025-03-13 05:55:38, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS NR_155303 685 bp RNA linear ROD 15-JAN-2024 DEFINITION Mus musculus homeobox B3 and homeobox B2, opposite strand (Hoxb3os), long non-coding RNA. ACCESSION NR_155303 VERSION NR_155303.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 685) AUTHORS Weisser I, Eckberg K, D'Amico S, Buttram D and Aboudehen K. TITLE Ablation of Long Noncoding RNA Hoxb3os Exacerbates Cystogenesis in Mouse Polycystic Kidney Disease JOURNAL J Am Soc Nephrol 35 (1), 41-55 (2024) PUBMED 37953472 REMARK GeneRIF: Ablation of Long Noncoding RNA Hoxb3os Exacerbates Cystogenesis in Mouse Polycystic Kidney Disease. REFERENCE 2 (bases 1 to 685) AUTHORS Peng G, Suo S, Cui G, Yu F, Wang R, Chen J, Chen S, Liu Z, Chen G, Qian Y, Tam PPL, Han JJ and Jing N. TITLE Molecular architecture of lineage allocation and tissue organization in early mouse embryo JOURNAL Nature 572 (7770), 528-532 (2019) PUBMED 31391582 REMARK Erratum:[Nature. 2020 Jan;577(7791):E6. PMID: 31896818] REFERENCE 3 (bases 1 to 685) AUTHORS Aboudehen K, Farahani S, Kanchwala M, Chan SC, Avdulov S, Mickelson A, Lee D, Gearhart MD, Patel V, Xing C and Igarashi P. TITLE Long noncoding RNA Hoxb3os is dysregulated in autosomal dominant polycystic kidney disease and regulates mTOR signaling JOURNAL J Biol Chem 293 (24), 9388-9398 (2018) PUBMED 29716997 REMARK GeneRIF: These findings identify Hoxb3os as a novel lncRNA that is down-regulated in Autosomal dominant polycystic kidney disease and regulates mTOR signaling and mitochondrial respiration. REFERENCE 4 (bases 1 to 685) AUTHORS Harrow JL, Steward CA, Frankish A, Gilbert JG, Gonzalez JM, Loveland JE, Mudge J, Sheppard D, Thomas M, Trevanion S and Wilming LG. TITLE The Vertebrate Genome Annotation browser 10 years on JOURNAL Nucleic Acids Res 42 (Database issue), D771-D779 (2014) PUBMED 24316575 REFERENCE 5 (bases 1 to 685) AUTHORS Chan KT, Qi J and Sham MH. TITLE Multiple coding and non-coding RNAs in the Hoxb3 locus and their spatial expression patterns during mouse embryogenesis JOURNAL Biochem Biophys Res Commun 398 (2), 153-159 (2010) PUBMED 20515659 REFERENCE 6 (bases 1 to 685) AUTHORS Studer M, Lumsden A, Ariza-McNaughton L, Bradley A and Krumlauf R. TITLE Altered segmental identity and abnormal migration of motor neurons in mice lacking Hoxb-1 JOURNAL Nature 384 (6610), 630-634 (1996) PUBMED 8967950 REFERENCE 7 (bases 1 to 685) AUTHORS Manley NR and Capecchi MR. TITLE The role of Hoxa-3 in mouse thymus and thyroid development JOURNAL Development 121 (7), 1989-2003 (1995) PUBMED 7635047 REFERENCE 8 (bases 1 to 685) AUTHORS Gendron-Maguire M, Mallo M, Zhang M and Gridley T. TITLE Hoxa-2 mutant mice exhibit homeotic transformation of skeletal elements derived from cranial neural crest JOURNAL Cell 75 (7), 1317-1331 (1993) PUBMED 7903600 REFERENCE 9 (bases 1 to 685) AUTHORS Swiatek PJ and Gridley T. TITLE Perinatal lethality and defects in hindbrain development in mice homozygous for a targeted mutation of the zinc finger gene Krox20 JOURNAL Genes Dev 7 (11), 2071-2084 (1993) PUBMED 8224839 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AL606824.13. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. ##Evidence-Data-START## Transcript exon combination :: BE847805.1, BE687976.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849382, SAMN00849385 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-335 AL606824.13 48100-48434 c 336-430 AL606824.13 43334-43428 c 431-493 AL606824.13 41867-41929 c 494-685 AL606824.13 38074-38265 c FEATURES Location/Qualifiers source 1..685 /organism="Mus musculus" /mol_type="transcribed RNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="11" /map="11 59.85 cM" gene 1..685 /gene="Hoxb3os" /gene_synonym="Gm11530; Hoxb3s" /note="homeobox B3 and homeobox B2, opposite strand" /db_xref="GeneID:102632302" /db_xref="MGI:MGI:103211" ncRNA 1..685 /ncRNA_class="lncRNA" /gene="Hoxb3os" /gene_synonym="Gm11530; Hoxb3s" /product="homeobox B3 and homeobox B2, opposite strand" /db_xref="GeneID:102632302" /db_xref="MGI:MGI:103211" exon 1..335 /gene="Hoxb3os" /gene_synonym="Gm11530; Hoxb3s" /inference="alignment:Splign:2.1.0" exon 336..430 /gene="Hoxb3os" /gene_synonym="Gm11530; Hoxb3s" /inference="alignment:Splign:2.1.0" exon 431..493 /gene="Hoxb3os" /gene_synonym="Gm11530; Hoxb3s" /inference="alignment:Splign:2.1.0" exon 494..685 /gene="Hoxb3os" /gene_synonym="Gm11530; Hoxb3s" /inference="alignment:Splign:2.1.0" ORIGIN
attgtgcagccggggctcgatgcgcccacactctccagggtggtggcaggcagcgctgacggcggtgcgccccggggtccctgcgcggcctcggcggggtggaagcaggcttcccgcagccggtgagtcgcgacgtcgcccgggctgaccgtgggttcctcggctggctctcccgcgtcgtcctgggcgctcggcccgcctggttctccctcgggcggctctcgatgctgcgtctgccgcttgtgtttcatgcgtcggttctggaaccagactttgacctgcctttcggtgaggtccagcaaggcagcgatctcgacgcgacgcggccggcacagacccaatgatggttgggcttcgggtcacgtgacagcctcattgtagctccggaagagaacgtgaagtttaggttgcctggaagaagcagtaataaggagactgaaagggagaacaaaaaaaatcaagattttggggaaattacccacagagatgcaagggaaaaagaaaaaggaaaaggaaaaactgtgcatctgctggaatctcttttctactgagatgggggaaattatccaggatgagaaagactcacaaaacaatttgaacactattcttctctggattcaaaggggaggctgtttactgaggttcccaacagcaaaaaataaaataaaataaaattatggtcact
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]