ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-27 10:12:49, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_030570 81 bp RNA linear ROD 05-AUG-2023
DEFINITION Mus musculus microRNA 466h (Mir466h), microRNA.
ACCESSION NR_030570
VERSION NR_030570.1
KEYWORDS RefSeq.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE 1 (bases 1 to 81)
AUTHORS Luo Y, Liang C, Xu Y and Zhang T.
TITLE MiR-466h-5p induces expression of myocardin with complementary
promoter sequences
JOURNAL Biochem Biophys Res Commun 514 (1), 187-193 (2019)
PUBMED 31029421
REMARK GeneRIF: MiR-466h-5p regulates the occurrence of myocardial
hypertrophy via myocardin and it can upregulate the expression of
myocardin through directly binding to the promoter region of
myocardin.
REFERENCE 2 (bases 1 to 81)
AUTHORS Polikepahad S and Corry DB.
TITLE Profiling of T helper cell-derived small RNAs reveals unique
antisense transcripts and differential association of miRNAs with
argonaute proteins 1 and 2
JOURNAL Nucleic Acids Res 41 (2), 1164-1177 (2013)
PUBMED 23185045
REFERENCE 3 (bases 1 to 81)
AUTHORS Druz A, Betenbaugh M and Shiloach J.
TITLE Glucose depletion activates mmu-miR-466h-5p expression through
oxidative stress and inhibition of histone deacetylation
JOURNAL Nucleic Acids Res 40 (15), 7291-7302 (2012)
PUBMED 22638581
REFERENCE 4 (bases 1 to 81)
AUTHORS Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G and
Adler H.
TITLE Identification and analysis of expression of novel microRNAs of
murine gammaherpesvirus 68
JOURNAL J Virol 84 (19), 10266-10275 (2010)
PUBMED 20668074
REFERENCE 5 (bases 1 to 81)
AUTHORS Pogribny IP, Starlard-Davenport A, Tryndyak VP, Han T, Ross SA,
Rusyn I and Beland FA.
TITLE Difference in expression of hepatic microRNAs miR-29c, miR-34a,
miR-155, and miR-200b is associated with strain-specific
susceptibility to dietary nonalcoholic steatohepatitis in mice
JOURNAL Lab Invest 90 (10), 1437-1446 (2010)
PUBMED 20548288
REFERENCE 6 (bases 1 to 81)
AUTHORS Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D,
Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP,
Nusbaum C and Bartel DP.
TITLE Mammalian microRNAs: experimental evaluation of novel and
previously annotated genes
JOURNAL Genes Dev 24 (10), 992-1009 (2010)
PUBMED 20413612
REFERENCE 7 (bases 1 to 81)
AUTHORS Calabrese JM, Seila AC, Yeo GW and Sharp PA.
TITLE RNA sequence analysis defines Dicer's role in mouse embryonic stem
cells
JOURNAL Proc Natl Acad Sci U S A 104 (46), 18097-18102 (2007)
PUBMED 17989215
REMARK Erratum:[Proc Natl Acad Sci U S A. 2007 Dec 26;104(52):21021]
REFERENCE 8 (bases 1 to 81)
AUTHORS Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A,
Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND,
Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U,
Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien
M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung
V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G,
Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P,
Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C,
Zavolan M and Tuschl T.
TITLE A mammalian microRNA expression atlas based on small RNA library
sequencing
JOURNAL Cell 129 (7), 1401-1414 (2007)
PUBMED 17604727
REFERENCE 9 (bases 1 to 81)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AL772216.15.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
##Evidence-Data-START##
Transcript is intronless :: SRR7652917.705794.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-81 AL772216.15 90925-91005
FEATURES Location/Qualifiers
source 1..81
/organism="Mus musculus"
/mol_type="transcribed RNA"
/strain="C57BL/6"
/db_xref="taxon:10090"
/chromosome="2"
/map="2 8.22 cM"
gene 1..81
/gene="Mir466h"
/gene_synonym="Mirn466h"
/note="microRNA 466h"
/db_xref="GeneID:100124446"
/db_xref="MGI:MGI:3718537"
/db_xref="miRBase:MI0005511"
precursor_RNA 1..81
/gene="Mir466h"
/gene_synonym="Mirn466h"
/product="microRNA 466h"
/db_xref="GeneID:100124446"
/db_xref="MGI:MGI:3718537"
/db_xref="miRBase:MI0005511"
exon 1..81
/gene="Mir466h"
/gene_synonym="Mirn466h"
/inference="alignment:Splign:2.1.0"
ncRNA 11..32
/ncRNA_class="miRNA"
/gene="Mir466h"
/gene_synonym="Mirn466h"
/product="mmu-miR-466h-5p"
/db_xref="miRBase:MIMAT0004884"
/db_xref="GeneID:100124446"
/db_xref="MGI:MGI:3718537"
/db_xref="miRBase:MI0005511"
ncRNA 50..68
/ncRNA_class="miRNA"
/gene="Mir466h"
/gene_synonym="Mirn466h"
/product="mmu-miR-466h-3p"
/db_xref="miRBase:MIMAT0017274"
/db_xref="GeneID:100124446"
/db_xref="MGI:MGI:3718537"
/db_xref="miRBase:MI0005511"
ORIGIN
tgtatatttgtgtgtgcatgtgcttgtgtgtatgtgaatatatatatcatacgcacgcacacacacacacaaatgcaagca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]