2024-09-28 09:26:23, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS NM_194063 1048 bp mRNA linear ROD 07-AUG-2023 DEFINITION Mus musculus reproductive homeobox 3A (Rhox3a), mRNA. ACCESSION NM_194063 XM_356321 VERSION NM_194063.3 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1048) AUTHORS Song HW, Bettegowda A, Oliver D, Yan W, Phan MH, de Rooij DG, Corbett MA and Wilkinson MF. TITLE shRNA off-target effects in vivo: impaired endogenous siRNA expression and spermatogenic defects JOURNAL PLoS One 10 (3), e0118549 (2015) PUBMED 25790000 REMARK GeneRIF: The Rhox3 shRNA causes spermatogenic defects by sequestering one or more components of the endogenous small RNA biogenesis machinery. Publication Status: Online-Only REFERENCE 2 (bases 1 to 1048) AUTHORS Hu Z, Shanker S, MacLean JA 2nd, Ackerman SL and Wilkinson MF. TITLE The RHOX5 homeodomain protein mediates transcriptional repression of the netrin-1 receptor gene Unc5c JOURNAL J Biol Chem 283 (7), 3866-3876 (2008) PUBMED 18077458 REFERENCE 3 (bases 1 to 1048) AUTHORS MacLean,J.A. 2nd, Lorenzetti,D., Hu,Z., Salerno,W.J., Miller,J. and Wilkinson,M.F. TITLE Rhox homeobox gene cluster: recent duplication of three family members JOURNAL Genesis 44 (3), 122-129 (2006) PUBMED 16496311 REFERENCE 4 (bases 1 to 1048) AUTHORS Morris L, Gordon J and Blackburn CC. TITLE Identification of a tandem duplicated array in the Rhox alpha locus on mouse chromosome X JOURNAL Mamm Genome 17 (2), 178-187 (2006) PUBMED 16465597 REFERENCE 5 (bases 1 to 1048) AUTHORS Maclean JA 2nd, Chen MA, Wayne CM, Bruce SR, Rao M, Meistrich ML, Macleod C and Wilkinson MF. TITLE Rhox: a new homeobox gene cluster JOURNAL Cell 120 (3), 369-382 (2005) PUBMED 15707895 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from DQ058640.1 and AL451076.14. On May 29, 2010 this sequence version replaced NM_194063.2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##Evidence-Data-START## Transcript exon combination :: DQ058640.1 [ECO:0000332] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-868 DQ058640.1 1-868 869-1048 AL451076.14 185349-185528 FEATURES Location/Qualifiers source 1..1048 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="X" /map="X 21.67 cM" gene 1..1048 /gene="Rhox3a" /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1" /note="reproductive homeobox 3A" /db_xref="GeneID:382209" /db_xref="MGI:MGI:2676626" exon 1..62 /gene="Rhox3a" /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1" /inference="alignment:Splign:2.1.0" exon 63..211 /gene="Rhox3a" /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1" /inference="alignment:Splign:2.1.0" exon 212..401 /gene="Rhox3a" /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1" /inference="alignment:Splign:2.1.0" CDS 221..868 /gene="Rhox3a" /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1" /note="reproductive homeobox 3; reproductive homeobox on X chromosome, 3; testis expressed homeobox 2" /codon_start=1 /product="reproductive homeobox 3A" /protein_id="NP_918952.2" /db_xref="CCDS:CCDS30076.1" /db_xref="GeneID:382209" /db_xref="MGI:MGI:2676626" /translation="
MSMKPERSISNWIHSNVERAGRNLFQVNGHRSALLPELPQDYHRASRSVNGCETKMDSTQGTKVLPAEEGKNEEDGGQVESALGATAARGRGKEALNGESPAAAGTAGLVEEDRNKEDGGTKGGEKNEQEVREQIPEHVEGESDQAEAPRQVPRRRLHHRFTQWQLDELERIFRMNYFLSLEARKQLARWMGVNEAIVKRWFQKRREQYRWYKRL"
misc_feature 683..853 /gene="Rhox3a" /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:238039" misc_feature order(683..697,701..703,752..754,770..772,809..811, 815..820,827..832,836..844,848..853) /gene="Rhox3a" /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(689..691,698..700,818..820,827..832,839..841) /gene="Rhox3a" /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" exon 402..771 /gene="Rhox3a" /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1" /inference="alignment:Splign:2.1.0" exon 772..817 /gene="Rhox3a" /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1" /inference="alignment:Splign:2.1.0" exon 818..1048 /gene="Rhox3a" /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1" /inference="alignment:Splign:2.1.0" ORIGIN
gcaaatttacaagagagatgatgcaggacccaaggagaaacagcagtctcttccaaactcagggaatcaatgtggagcactagaccaagaggtagttctacaaacattttcctcaagggctccagagttactgggagatattttcttgctccccacaacttggcttctacagttgaccaccatcccctcggtaggaagaaaattcaataagcaacaggtgatgagcatgaagccagaacgttccatctctaactggatacatagtaatgtggaacgggctggaagaaatctcttccaggtcaacggtcaccgctctgctctattaccggaactacctcaggattaccacagagcttcaaggtcagtcaacggatgtgagactaaaatggacagcacccaaggtaccaaggttttgccggctgaagagggaaaaaatgaagaagatggaggacaggtggagtcggcattgggagccacagccgcaaggggtagaggaaaagaagcattaaatggagagagtcccgccgctgctggcactgcaggccttgtagaggaagacaggaacaaggaagatggtggcaccaagggaggtgagaagaatgagcaggaagtgagggagcagattcctgagcatgttgaaggagagagtgaccaggctgaagcgccaaggcaggtgccacgacgtcgattgcaccatagattcacccagtggcagctggacgaactggagagaattttccggatgaattattttctcagtctagaagcaagaaaacaactggcccgatggatgggtgtgaatgaagccatagtgaagagatggtttcagaagaggagagaacaatacaggtggtataagaggctataaggtctcagaagttctcctcctgcttctcagaacatctttcctgaagactgtggaggaaccctgcagtgccactatcgccaaggcaacatagagagaggaattgctttcgtctcctaacgatatgttattaaactcttatatctgaagcgattatatttcaataacaatatgaattttcaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]