LOCUS       NM_029103                868 bp    mRNA    linear   ROD 17-NOV-2024
DEFINITION  Mus musculus mesencephalic astrocyte-derived neurotrophic factor
            (Manf), mRNA.
ACCESSION   NM_029103
VERSION     NM_029103.4
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 868)
  AUTHORS   Liang,Y., Mei,Q., He,E., Ballar,P., Wei,C., Wang,Y., Dong,Y.,
            Zhou,J., Tao,X., Qu,W., Zhao,M., Chhetri,G., Wei,L., Shao,J.,
            Shen,Y., Liu,J., Feng,L. and Shen,Y.
  TITLE     MANF serves as a novel hepatocyte factor to promote liver
            regeneration after 2/3 partial hepatectomy via doubly targeting
            Wnt/beta-catenin signaling
  JOURNAL   Cell Death Dis 15 (9), 681 (2024)
   PUBMED   39289348
  REMARK    GeneRIF: MANF serves as a novel hepatocyte factor to promote liver
            regeneration after 2/3 partial hepatectomy via doubly targeting
            Wnt/beta-catenin signaling.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 868)
  AUTHORS   Wen,W., Li,H., Lauffer,M., Hu,D., Zhang,Z., Lin,H., Wang,Y.,
            Leidinger,M. and Luo,J.
  TITLE     Sex-specific effects of alcohol on neurobehavioral performance and
            endoplasmic reticulum stress: an analysis using neuron-specific
            MANF deficient mice
  JOURNAL   Front Pharmacol 15, 1407576 (2024)
   PUBMED   39130640
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 868)
  AUTHORS   Fang,Y., Zhang,J., Zhu,D., Mei,Q., Liao,T., Cheng,H., He,Y., Cao,Y.
            and Wei,Z.
  TITLE     MANF Promotes Unexplained Recurrent Miscarriages by Interacting
            with NPM1 and Downregulating Trophoblast Cell Migration and
            Invasion
  JOURNAL   Int J Biol Sci 20 (1), 296-311 (2024)
   PUBMED   38164189
  REMARK    GeneRIF: MANF Promotes Unexplained Recurrent Miscarriages by
            Interacting with NPM1 and Downregulating Trophoblast Cell Migration
            and Invasion.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 868)
  AUTHORS   Zhou,C., Han,D., Fang,H., Huang,D., Cai,H., Shen,Y., Shen,Y. and
            Liu,J.
  TITLE     Deletion of mesencephalic astrocyte-derived neurotrophic factor
            delays and damages the development of white pulp in spleen
  JOURNAL   Immunobiology 229 (1), 152778 (2024)
   PUBMED   38159526
  REMARK    GeneRIF: Deletion of mesencephalic astrocyte-derived neurotrophic
            factor delays and damages the development of white pulp in spleen.
REFERENCE   5  (bases 1 to 868)
  AUTHORS   Xie,H., Deng,H., Yang,X., Gao,X., Yang,S., Chen,W., Wang,Y.,
            Yang,N., Yong,L. and Hou,X.
  TITLE     Mesencephalic Astrocyte-derived Neurotrophic Factor Supports
            Hepatitis B Virus-induced Immunotolerance
  JOURNAL   Cell Mol Gastroenterol Hepatol 18 (3), 101360 (2024)
   PUBMED   38759839
  REMARK    GeneRIF: Mesencephalic Astrocyte-derived Neurotrophic Factor
            Supports Hepatitis B Virus-induced Immunotolerance.
REFERENCE   6  (bases 1 to 868)
  AUTHORS   Hoseki,J., Sasakawa,H., Yamaguchi,Y., Maeda,M., Kubota,H., Kato,K.
            and Nagata,K.
  TITLE     Solution structure and dynamics of mouse ARMET
  JOURNAL   FEBS Lett 584 (8), 1536-1542 (2010)
   PUBMED   20214902
  REMARK    GeneRIF: the solution structure of ARMET
REFERENCE   7  (bases 1 to 868)
  AUTHORS   Lindholm,P., Peranen,J., Andressoo,J.O., Kalkkinen,N., Kokaia,Z.,
            Lindvall,O., Timmusk,T. and Saarma,M.
  TITLE     MANF is widely expressed in mammalian tissues and differently
            regulated after ischemic and epileptic insults in rodent brain
  JOURNAL   Mol Cell Neurosci 39 (3), 356-371 (2008)
   PUBMED   18718866
  REMARK    GeneRIF: The widespread expression of MANF together with its
            evolutionary conserved nature and regulation by brain insults
            suggest that it has important functions both under normal and
            pathological conditions in many tissue types.
REFERENCE   8  (bases 1 to 868)
  AUTHORS   Mizobuchi,N., Hoseki,J., Kubota,H., Toyokuni,S., Nozaki,J.,
            Naitoh,M., Koizumi,A. and Nagata,K.
  TITLE     ARMET is a soluble ER protein induced by the unfolded protein
            response via ERSE-II element
  JOURNAL   Cell Struct Funct 32 (1), 41-50 (2007)
   PUBMED   17507765
  REMARK    GeneRIF: ARMET is the second fully characterized ERSE-II-dependent
            gene and likely contributes to quality control of proteins in the
            endoplasmic reticulum
REFERENCE   9  (bases 1 to 868)
  AUTHORS   Barclay,J., Balaguero,N., Mione,M., Ackerman,S.L., Letts,V.A.,
            Brodbeck,J., Canti,C., Meir,A., Page,K.M., Kusumi,K.,
            Perez-Reyes,E., Lander,E.S., Frankel,W.N., Gardiner,R.M.,
            Dolphin,A.C. and Rees,M.
  TITLE     Ducky mouse phenotype of epilepsy and ataxia is associated with
            mutations in the Cacna2d2 gene and decreased calcium channel
            current in cerebellar Purkinje cells
  JOURNAL   J Neurosci 21 (16), 6095-6104 (2001)
   PUBMED   11487633
REFERENCE   10 (bases 1 to 868)
  AUTHORS   Kawamoto,S., Matsumoto,Y., Mizuno,K., Okubo,K. and Matsubara,K.
  TITLE     Expression profiles of active genes in human and mouse livers
  JOURNAL   Gene 174 (1), 151-158 (1996)
   PUBMED   8863742
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK131997.1.
            
            On Jun 20, 2018 this sequence version replaced NM_029103.3.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK131997.1, BB611038.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849384, SAMN00849386
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-868               AK131997.1         2-869
FEATURES             Location/Qualifiers
     source          1..868
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="9"
                     /map="9 57.98 cM"
     gene            1..868
                     /gene="Manf"
                     /gene_synonym="3230402M22Rik; Armet; D18Mgi17"
                     /note="mesencephalic astrocyte-derived neurotrophic
                     factor"
                     /db_xref="GeneID:74840"
                     /db_xref="MGI:MGI:1922090"
     exon            1..125
                     /gene="Manf"
                     /gene_synonym="3230402M22Rik; Armet; D18Mgi17"
                     /inference="alignment:Splign:2.1.0"
     CDS             41..580
                     /gene="Manf"
                     /gene_synonym="3230402M22Rik; Armet; D18Mgi17"
                     /note="arginine-rich, mutated in early stage tumors;
                     arginine-rich protein"
                     /codon_start=1
                     /product="mesencephalic astrocyte-derived neurotrophic
                     factor precursor"
                     /protein_id="NP_083379.2"
                     /db_xref="CCDS:CCDS23486.1"
                     /db_xref="GeneID:74840"
                     /db_xref="MGI:MGI:1922090"
                     /translation="

MWATRGLAVALALSVLPDSRALRPGDCEVCISYLGRFYQDLKDRDVTFSPATIEEELIKFCREARGKENRLCYYIGATDDAATKIINEVSKPLAHHIPVEKICEKLKKKDSQICELKYDKQIDLSTVDLKKLRVKELKKILDDWGEMCKGCAEKSDYIRKINELMPKYAPKAASARTDL"

     sig_peptide     41..103
                     /gene="Manf"
                     /gene_synonym="3230402M22Rik; Armet; D18Mgi17"
                     /inference="COORDINATES: ab initio prediction:SignalP:6.0"
     mat_peptide     104..577
                     /gene="Manf"
                     /gene_synonym="3230402M22Rik; Armet; D18Mgi17"
                     /product="Mesencephalic astrocyte-derived neurotrophic
                     factor. /id=PRO_0000002306"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9CXI5.2)"
     misc_feature    116..406
                     /gene="Manf"
                     /gene_synonym="3230402M22Rik; Armet; D18Mgi17"
                     /note="ARMET, N-terminal; Region: ARMET_N; pfam20145"
                     /db_xref="CDD:466306"
     misc_feature    257..259
                     /gene="Manf"
                     /gene_synonym="3230402M22Rik; Armet; D18Mgi17"
                     /note="Phosphotyrosine.
                     /evidence=ECO:0007744|PubMed:18034455; propagated from
                     UniProtKB/Swiss-Prot (Q9CXI5.2); phosphorylation site"
     misc_feature    416..544
                     /gene="Manf"
                     /gene_synonym="3230402M22Rik; Armet; D18Mgi17"
                     /note="ARMET, C-terminal; Region: ARMET_C; pfam10208"
                     /db_xref="CDD:462997"
     exon            126..253
                     /gene="Manf"
                     /gene_synonym="3230402M22Rik; Armet; D18Mgi17"
                     /inference="alignment:Splign:2.1.0"
     exon            254..395
                     /gene="Manf"
                     /gene_synonym="3230402M22Rik; Armet; D18Mgi17"
                     /inference="alignment:Splign:2.1.0"
     exon            396..868
                     /gene="Manf"
                     /gene_synonym="3230402M22Rik; Armet; D18Mgi17"
                     /inference="alignment:Splign:2.1.0"
     regulatory      840..845
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Manf"
                     /gene_synonym="3230402M22Rik; Armet; D18Mgi17"
                     /note="hexamer: ATTAAA"
     polyA_site      861
                     /gene="Manf"
                     /gene_synonym="3230402M22Rik; Armet; D18Mgi17"
                     /note="major polyA site"
ORIGIN      

attcgcgcggcggcggcggtggtggagacggctgaggaggatgtgggctacgcgcgggctggcggtagcgctggccctgagcgtgctgcctgacagccgggcgctgcggccaggagactgtgaagtttgtatttcttatctgggacgattttaccaggacctcaaagacagagatgtcacattttcaccagccactattgaagaagaacttataaagttttgccgtgaagcaagaggcaaagagaatcggttgtgctactacattggagccacagatgatgctgccaccaagatcatcaatgaggtgtcgaagcccctggcccaccatatccctgtggaaaagatctgtgagaagctgaagaagaaagacagccagatctgtgaactaaaatacgacaagcagattgacctgagcacagtggacctgaagaagctccgggtgaaagagctgaagaagatcctggacgactggggggagatgtgcaaaggctgtgcagaaaagtctgactatatccggaagataaatgaactgatgcctaaatacgcccccaaggcagccagcgcacggactgatctgtagtctgcccaattcctgctgcacctgaaggggaaaaagcagtttatctgtctcttccccaaataaccattttgtaatttattttttaagcgggctcctgacaatgagatgtgaacctagagctttcctagtgatgctggctctgcagttccctcttgcccatccccgagtggggacaatttccccatccccaagtggggacaatttacttccttctttgctggtttactctaggacttcaaagtttgtctgggatttttttattaaaaaaaattgtctttggagagttga

//