ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-07-03 00:56:02, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_020284 1335 bp mRNA linear ROD 23-JUN-2025
DEFINITION Mus musculus cathepsin R (Ctsr), mRNA.
ACCESSION NM_020284
VERSION NM_020284.1
KEYWORDS RefSeq; RefSeq Select.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE 1 (bases 1 to 1335)
AUTHORS Thompson,C.L., Ng,L., Menon,V., Martinez,S., Lee,C.K.,
Glattfelder,K., Sunkin,S.M., Henry,A., Lau,C., Dang,C.,
Garcia-Lopez,R., Martinez-Ferre,A., Pombero,A., Rubenstein,J.L.R.,
Wakeman,W.B., Hohmann,J., Dee,N., Sodt,A.J., Young,R., Smith,K.,
Nguyen,T.N., Kidney,J., Kuan,L., Jeromin,A., Kaykas,A., Miller,J.,
Page,D., Orta,G., Bernard,A., Riley,Z., Smith,S., Wohnoutka,P.,
Hawrylycz,M.J., Puelles,L. and Jones,A.R.
TITLE A high-resolution spatiotemporal atlas of gene expression of the
developing mouse brain
JOURNAL Neuron 83 (2), 309-323 (2014)
PUBMED 24952961
REFERENCE 2 (bases 1 to 1335)
AUTHORS Kim,J., Frey,W.D., He,H., Kim,H., Ekram,M.B., Bakshi,A., Faisal,M.,
Perera,B.P., Ye,A. and Teruyama,R.
TITLE Peg3 mutational effects on reproduction and placenta-specific gene
families
JOURNAL PLoS One 8 (12), e83359 (2013)
PUBMED 24391757
REMARK Erratum:[PLoS One. 2014;9(1).
doi:10.1371/annotation/8de03ec5-e62c-4135-87ee-4928475090a8]
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 1335)
AUTHORS Shalom-Barak,T., Zhang,X., Chu,T., Timothy Schaiff,W., Reddy,J.K.,
Xu,J., Sadovsky,Y. and Barak,Y.
TITLE Placental PPARgamma regulates spatiotemporally diverse genes and a
unique metabolic network
JOURNAL Dev Biol 372 (1), 143-155 (2012)
PUBMED 22967998
REFERENCE 4 (bases 1 to 1335)
AUTHORS Liu,P., Wang,Y., Vikis,H., Maciag,A., Wang,D., Lu,Y., Liu,Y. and
You,M.
TITLE Candidate lung tumor susceptibility genes identified through
whole-genome association analyses in inbred mice
JOURNAL Nat Genet 38 (8), 888-895 (2006)
PUBMED 16862160
REFERENCE 5 (bases 1 to 1335)
AUTHORS Zimonjic,D.B., Liu,J., Xu,W.H., Zhou,X., Popescu,N.C. and Shi,G.P.
TITLE Assignment of murine placental cathepsin R to mouse chromosome
bands 13B2-B3 by fluorescence in situ hybridization
JOURNAL Cytogenet Genome Res 111 (1), 96 (2005)
PUBMED 16097084
REMARK GeneRIF: chromosome mapping of this enzyme in mouse placenta.
REFERENCE 6 (bases 1 to 1335)
AUTHORS Ishida,M., Ono,K., Taguchi,S., Ohashi,S., Naito,J., Horiguchi,K.
and Harigaya,T.
TITLE Cathepsin gene expression in mouse placenta during the latter half
of pregnancy
JOURNAL J Reprod Dev 50 (5), 515-523 (2004)
PUBMED 15514457
REMARK GeneRIF: Possible association of cathepsins with placental
lactogen-II may play important roles in placental functions during
the latter half of pregnancy in mice.
REFERENCE 7 (bases 1 to 1335)
AUTHORS Deussing,J., Kouadio,M., Rehman,S., Werber,I., Schwinde,A. and
Peters,C.
TITLE Identification and characterization of a dense cluster of
placenta-specific cysteine peptidase genes and related genes on
mouse chromosome 13
JOURNAL Genomics 79 (2), 225-240 (2002)
PUBMED 11829493
REFERENCE 8 (bases 1 to 1335)
AUTHORS Sol-Church,K., Frenck,J., Bertenshaw,G. and Mason,R.W.
TITLE Characterization of mouse cathepsin R, a new member of a family of
placentally expressed cysteine proteases
JOURNAL Biochim Biophys Acta 1492 (2-3), 488-492 (2000)
PUBMED 11004518
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from AF245399.1.
##Evidence-Data-START##
Transcript exon combination :: AF245399.1, AK014432.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMN01164134 [ECO:0000348]
##Evidence-Data-END##
##RefSeq-Attributes-START##
RefSeq Select criteria :: based on single protein-coding transcript
##RefSeq-Attributes-END##
FEATURES Location/Qualifiers
source 1..1335
/organism="Mus musculus"
/mol_type="mRNA"
/strain="C57BL/6"
/db_xref="taxon:10090"
/chromosome="13"
/map="13 32.67 cM"
gene 1..1335
/gene="Ctsr"
/note="cathepsin R"
/db_xref="GeneID:56835"
/db_xref="MGI:MGI:1861723"
exon 1..58
/gene="Ctsr"
/inference="alignment:Splign:2.1.0"
exon 59..195
/gene="Ctsr"
/inference="alignment:Splign:2.1.0"
misc_feature 64..66
/gene="Ctsr"
/note="upstream in-frame stop codon"
CDS 70..1074
/gene="Ctsr"
/note="lysosomal cysteine protease"
/codon_start=1
/product="cathepsin R precursor"
/protein_id="NP_064680.1"
/db_xref="CCDS:CCDS26585.1"
/db_xref="GeneID:56835"
/db_xref="MGI:MGI:1861723"
/translation="
MAAVVFIAFLYLGVASGVPVLDSSLDAEWQDWKIKYNKSYSLKEEKLKRVVWEEKLKMIKLHNRENSLGKNGFTMKMNEFGDQTDEEFRKMMIEISVWTHREGKSIMKREAGSILPKFVDWRKKGYVTPVRRQGDCDACWAFAVTGAIEAQAIWQTGKLTPLSVQNLVDCSKPQGNNGCLGGDTYNAFQYVLHNGGLESEATYPYEGKDGPCRYNPKNSKAEITGFVSLPQSEDILMAAVATIGPITAGIDASHESFKNYKGGIYHEPNCSSDTVTHGVLVVGYGFKGIETDGNHYWLIKNSWGKRWGIRGYMKLAKDKNNHCGIASYAHYPTI"
sig_peptide 70..120
/gene="Ctsr"
/inference="COORDINATES: ab initio prediction:SignalP:6.0"
misc_feature 154..330
/gene="Ctsr"
/note="Cathepsin propeptide inhibitor domain (I29);
Region: Inhibitor_I29; smart00848"
/db_xref="CDD:214853"
mat_peptide 412..1071
/gene="Ctsr"
/product="Cathepsin R. /id=PRO_0000026284"
/note="propagated from UniProtKB/Swiss-Prot (Q9JIA9.1)"
misc_feature 415..1065
/gene="Ctsr"
/note="Peptidase C1A subfamily (MEROPS database
nomenclature); composed of cysteine peptidases (CPs)
similar to papain, including the mammalian CPs (cathepsins
B, C, F, H, L, K, O, S, V, X and W). Papain is an
endopeptidase with specific substrate preferences; Region:
Peptidase_C1A; cd02248"
/db_xref="CDD:239068"
misc_feature order(466..468,484..486,898..900,970..972)
/gene="Ctsr"
/note="active site"
/db_xref="CDD:239068"
misc_feature order(616..621,814..816,892..894,901..903,1051..1053)
/gene="Ctsr"
/note="S2 subsite [active]"
/db_xref="CDD:239068"
misc_feature 874..876
/gene="Ctsr"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (Q9JIA9.1); glycosylation site"
exon 196..318
/gene="Ctsr"
/inference="alignment:Splign:2.1.0"
exon 319..468
/gene="Ctsr"
/inference="alignment:Splign:2.1.0"
exon 469..693
/gene="Ctsr"
/inference="alignment:Splign:2.1.0"
exon 694..856
/gene="Ctsr"
/inference="alignment:Splign:2.1.0"
exon 857..974
/gene="Ctsr"
/inference="alignment:Splign:2.1.0"
exon 975..1335
/gene="Ctsr"
/inference="alignment:Splign:2.1.0"
ORIGIN
agcaacttttgaagagttgagtctgtggagtggattgaggcagaggcagtcacctcaggtacttgagacatggctgctgttgtcttcatagccttcctgtatttgggagtggcctcaggtgttccagtacttgattcaagtttggatgctgaatggcaagactggaagataaagtataacaaatcatatagcctgaaggaagaaaaactgaagagagtggtttgggaagaaaaattgaaaatgatcaaactacacaacagggagaacagcctgggtaagaatggcttcaccatgaaaatgaatgaatttggtgaccagactgatgaagaattcaggaaaatgatgattgaaatttcagtttggactcacagagaggggaaaagtatcatgaaacgggaagctggcagtattctccccaaatttgtcgattggcgaaagaaaggatatgtgactcctgtacggagacagggagattgtgatgcttgttgggcatttgctgtgactggtgccatagaagcacaggcaatctggcaaacgggcaaactcacccctctgagtgtgcagaacctggtggactgttctaaacctcaaggcaacaatggttgtcttggtggtgatacatacaatgccttccagtatgttttgcacaatggtggtctggagtctgaggcaacatatccatatgaagggaaagatggaccatgcaggtataatccaaagaattctaaggctgaaatcacaggatttgtgtccctcccccaaagtgaggatatcctaatggctgctgtagcaactattgggcccatcactgctggaattgatgcttcacatgagtctttcaagaactataagggaggtatttaccatgagccaaattgtagcagtgatactgtgactcatggagtcctcgtggttggttacggatttaagggaattgagaccgatggtaatcactactggctgatcaagaatagctggggtaaacgatggggcattagaggctacatgaagctcgccaaagacaagaacaaccactgtggaattgcttcatatgctcactaccctactatttgagcaacctggtggccacaaggaaggttttggcacaagacagcatttctaggggagggctatctgctagtcagcgaccagcctttgcttggtatattcaagacttgtgtccctgaagagcaaccttgtaatgtgattctgggacccttcaactattttgacatcatgaacactattgctctaactaacgtatgtttattattccttcaaaaaaatcagctttaccgattgtgcaaataaaatcctttaaaaaataaaatgcaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]