GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-07-03 00:56:02, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_020284               1335 bp    mRNA    linear   ROD 23-JUN-2025
DEFINITION  Mus musculus cathepsin R (Ctsr), mRNA.
ACCESSION   NM_020284
VERSION     NM_020284.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1335)
  AUTHORS   Thompson,C.L., Ng,L., Menon,V., Martinez,S., Lee,C.K.,
            Glattfelder,K., Sunkin,S.M., Henry,A., Lau,C., Dang,C.,
            Garcia-Lopez,R., Martinez-Ferre,A., Pombero,A., Rubenstein,J.L.R.,
            Wakeman,W.B., Hohmann,J., Dee,N., Sodt,A.J., Young,R., Smith,K.,
            Nguyen,T.N., Kidney,J., Kuan,L., Jeromin,A., Kaykas,A., Miller,J.,
            Page,D., Orta,G., Bernard,A., Riley,Z., Smith,S., Wohnoutka,P.,
            Hawrylycz,M.J., Puelles,L. and Jones,A.R.
  TITLE     A high-resolution spatiotemporal atlas of gene expression of the
            developing mouse brain
  JOURNAL   Neuron 83 (2), 309-323 (2014)
   PUBMED   24952961
REFERENCE   2  (bases 1 to 1335)
  AUTHORS   Kim,J., Frey,W.D., He,H., Kim,H., Ekram,M.B., Bakshi,A., Faisal,M.,
            Perera,B.P., Ye,A. and Teruyama,R.
  TITLE     Peg3 mutational effects on reproduction and placenta-specific gene
            families
  JOURNAL   PLoS One 8 (12), e83359 (2013)
   PUBMED   24391757
  REMARK    Erratum:[PLoS One. 2014;9(1).
            doi:10.1371/annotation/8de03ec5-e62c-4135-87ee-4928475090a8]
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1335)
  AUTHORS   Shalom-Barak,T., Zhang,X., Chu,T., Timothy Schaiff,W., Reddy,J.K.,
            Xu,J., Sadovsky,Y. and Barak,Y.
  TITLE     Placental PPARgamma regulates spatiotemporally diverse genes and a
            unique metabolic network
  JOURNAL   Dev Biol 372 (1), 143-155 (2012)
   PUBMED   22967998
REFERENCE   4  (bases 1 to 1335)
  AUTHORS   Liu,P., Wang,Y., Vikis,H., Maciag,A., Wang,D., Lu,Y., Liu,Y. and
            You,M.
  TITLE     Candidate lung tumor susceptibility genes identified through
            whole-genome association analyses in inbred mice
  JOURNAL   Nat Genet 38 (8), 888-895 (2006)
   PUBMED   16862160
REFERENCE   5  (bases 1 to 1335)
  AUTHORS   Zimonjic,D.B., Liu,J., Xu,W.H., Zhou,X., Popescu,N.C. and Shi,G.P.
  TITLE     Assignment of murine placental cathepsin R to mouse chromosome
            bands 13B2-B3 by fluorescence in situ hybridization
  JOURNAL   Cytogenet Genome Res 111 (1), 96 (2005)
   PUBMED   16097084
  REMARK    GeneRIF: chromosome mapping of this enzyme in mouse placenta.
REFERENCE   6  (bases 1 to 1335)
  AUTHORS   Ishida,M., Ono,K., Taguchi,S., Ohashi,S., Naito,J., Horiguchi,K.
            and Harigaya,T.
  TITLE     Cathepsin gene expression in mouse placenta during the latter half
            of pregnancy
  JOURNAL   J Reprod Dev 50 (5), 515-523 (2004)
   PUBMED   15514457
  REMARK    GeneRIF: Possible association of cathepsins with placental
            lactogen-II may play important roles in placental functions during
            the latter half of pregnancy in mice.
REFERENCE   7  (bases 1 to 1335)
  AUTHORS   Deussing,J., Kouadio,M., Rehman,S., Werber,I., Schwinde,A. and
            Peters,C.
  TITLE     Identification and characterization of a dense cluster of
            placenta-specific cysteine peptidase genes and related genes on
            mouse chromosome 13
  JOURNAL   Genomics 79 (2), 225-240 (2002)
   PUBMED   11829493
REFERENCE   8  (bases 1 to 1335)
  AUTHORS   Sol-Church,K., Frenck,J., Bertenshaw,G. and Mason,R.W.
  TITLE     Characterization of mouse cathepsin R, a new member of a family of
            placentally expressed cysteine proteases
  JOURNAL   Biochim Biophys Acta 1492 (2-3), 488-492 (2000)
   PUBMED   11004518
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF245399.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF245399.1, AK014432.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN01164134 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1335
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="13"
                     /map="13 32.67 cM"
     gene            1..1335
                     /gene="Ctsr"
                     /note="cathepsin R"
                     /db_xref="GeneID:56835"
                     /db_xref="MGI:MGI:1861723"
     exon            1..58
                     /gene="Ctsr"
                     /inference="alignment:Splign:2.1.0"
     exon            59..195
                     /gene="Ctsr"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    64..66
                     /gene="Ctsr"
                     /note="upstream in-frame stop codon"
     CDS             70..1074
                     /gene="Ctsr"
                     /note="lysosomal cysteine protease"
                     /codon_start=1
                     /product="cathepsin R precursor"
                     /protein_id="NP_064680.1"
                     /db_xref="CCDS:CCDS26585.1"
                     /db_xref="GeneID:56835"
                     /db_xref="MGI:MGI:1861723"
                     /translation="
MAAVVFIAFLYLGVASGVPVLDSSLDAEWQDWKIKYNKSYSLKEEKLKRVVWEEKLKMIKLHNRENSLGKNGFTMKMNEFGDQTDEEFRKMMIEISVWTHREGKSIMKREAGSILPKFVDWRKKGYVTPVRRQGDCDACWAFAVTGAIEAQAIWQTGKLTPLSVQNLVDCSKPQGNNGCLGGDTYNAFQYVLHNGGLESEATYPYEGKDGPCRYNPKNSKAEITGFVSLPQSEDILMAAVATIGPITAGIDASHESFKNYKGGIYHEPNCSSDTVTHGVLVVGYGFKGIETDGNHYWLIKNSWGKRWGIRGYMKLAKDKNNHCGIASYAHYPTI"
     sig_peptide     70..120
                     /gene="Ctsr"
                     /inference="COORDINATES: ab initio prediction:SignalP:6.0"
     misc_feature    154..330
                     /gene="Ctsr"
                     /note="Cathepsin propeptide inhibitor domain (I29);
                     Region: Inhibitor_I29; smart00848"
                     /db_xref="CDD:214853"
     mat_peptide     412..1071
                     /gene="Ctsr"
                     /product="Cathepsin R. /id=PRO_0000026284"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9JIA9.1)"
     misc_feature    415..1065
                     /gene="Ctsr"
                     /note="Peptidase C1A subfamily (MEROPS database
                     nomenclature); composed of cysteine peptidases (CPs)
                     similar to papain, including the mammalian CPs (cathepsins
                     B, C, F, H, L, K, O, S, V, X and W). Papain is an
                     endopeptidase with specific substrate preferences; Region:
                     Peptidase_C1A; cd02248"
                     /db_xref="CDD:239068"
     misc_feature    order(466..468,484..486,898..900,970..972)
                     /gene="Ctsr"
                     /note="active site"
                     /db_xref="CDD:239068"
     misc_feature    order(616..621,814..816,892..894,901..903,1051..1053)
                     /gene="Ctsr"
                     /note="S2 subsite [active]"
                     /db_xref="CDD:239068"
     misc_feature    874..876
                     /gene="Ctsr"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q9JIA9.1); glycosylation site"
     exon            196..318
                     /gene="Ctsr"
                     /inference="alignment:Splign:2.1.0"
     exon            319..468
                     /gene="Ctsr"
                     /inference="alignment:Splign:2.1.0"
     exon            469..693
                     /gene="Ctsr"
                     /inference="alignment:Splign:2.1.0"
     exon            694..856
                     /gene="Ctsr"
                     /inference="alignment:Splign:2.1.0"
     exon            857..974
                     /gene="Ctsr"
                     /inference="alignment:Splign:2.1.0"
     exon            975..1335
                     /gene="Ctsr"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
agcaacttttgaagagttgagtctgtggagtggattgaggcagaggcagtcacctcaggtacttgagacatggctgctgttgtcttcatagccttcctgtatttgggagtggcctcaggtgttccagtacttgattcaagtttggatgctgaatggcaagactggaagataaagtataacaaatcatatagcctgaaggaagaaaaactgaagagagtggtttgggaagaaaaattgaaaatgatcaaactacacaacagggagaacagcctgggtaagaatggcttcaccatgaaaatgaatgaatttggtgaccagactgatgaagaattcaggaaaatgatgattgaaatttcagtttggactcacagagaggggaaaagtatcatgaaacgggaagctggcagtattctccccaaatttgtcgattggcgaaagaaaggatatgtgactcctgtacggagacagggagattgtgatgcttgttgggcatttgctgtgactggtgccatagaagcacaggcaatctggcaaacgggcaaactcacccctctgagtgtgcagaacctggtggactgttctaaacctcaaggcaacaatggttgtcttggtggtgatacatacaatgccttccagtatgttttgcacaatggtggtctggagtctgaggcaacatatccatatgaagggaaagatggaccatgcaggtataatccaaagaattctaaggctgaaatcacaggatttgtgtccctcccccaaagtgaggatatcctaatggctgctgtagcaactattgggcccatcactgctggaattgatgcttcacatgagtctttcaagaactataagggaggtatttaccatgagccaaattgtagcagtgatactgtgactcatggagtcctcgtggttggttacggatttaagggaattgagaccgatggtaatcactactggctgatcaagaatagctggggtaaacgatggggcattagaggctacatgaagctcgccaaagacaagaacaaccactgtggaattgcttcatatgctcactaccctactatttgagcaacctggtggccacaaggaaggttttggcacaagacagcatttctaggggagggctatctgctagtcagcgaccagcctttgcttggtatattcaagacttgtgtccctgaagagcaaccttgtaatgtgattctgggacccttcaactattttgacatcatgaacactattgctctaactaacgtatgtttattattccttcaaaaaaatcagctttaccgattgtgcaaataaaatcctttaaaaaataaaatgcaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]