LOCUS       NM_014194               1075 bp    mRNA    linear   ROD 23-JUN-2025
DEFINITION  Mus musculus killer cell lectin-like receptor, subfamily A, member
            7 (Klra7), transcript variant 2, mRNA.
ACCESSION   NM_014194
VERSION     NM_014194.5
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1075)
  AUTHORS   Adams,D.J., Barlas,B., McIntyre,R.E., Salguero,I., van der
            Weyden,L., Barros,A., Vicente,J.R., Karimpour,N., Haider,A.,
            Ranzani,M., Turner,G., Thompson,N.A., Harle,V., Olvera-Leon,R.,
            Robles-Espinoza,C.D., Speak,A.O., Geisler,N., Weninger,W.J.,
            Geyer,S.H., Hewinson,J., Karp,N.A., Fu,B., Yang,F., Kozik,Z.,
            Choudhary,J., Yu,L., van Ruiten,M.S., Rowland,B.D., Lelliott,C.J.,
            Del Castillo Velasco-Herrera,M., Verstraten,R., Bruckner,L.,
            Henssen,A.G., Rooimans,M.A., de Lange,J., Mohun,T.J., Arends,M.J.,
            Kentistou,K.A., Coelho,P.A., Zhao,Y., Zecchini,H., Perry,J.R.B.,
            Jackson,S.P. and Balmus,G.
  CONSRTM   Sanger Mouse Genetics Project
  TITLE     Genetic determinants of micronucleus formation in vivo
  JOURNAL   Nature 627 (8002), 130-136 (2024)
   PUBMED   38355793
REFERENCE   2  (bases 1 to 1075)
  AUTHORS   Parikh,B.A., Bern,M.D., Piersma,S.J., Yang,L., Beckman,D.L.,
            Poursine-Laurent,J., Plougastel-Douglas,B. and Yokoyama,W.M.
  TITLE     Control of Viral Infection by Natural Killer Cell Inhibitory
            Receptors
  JOURNAL   Cell Rep 32 (4), 107969 (2020)
   PUBMED   32726632
REFERENCE   3  (bases 1 to 1075)
  AUTHORS   Gays,F., Taha,S. and Brooks,C.G.
  TITLE     The distal upstream promoter in Ly49 genes, Pro1, is active in
            mature NK cells and T cells, does not require TATA boxes, and
            displays enhancer activity
  JOURNAL   J Immunol 194 (12), 6068-6081 (2015)
   PUBMED   25926675
REFERENCE   4  (bases 1 to 1075)
  AUTHORS   Ma,B.J., Craveiro Salvado,C.M. and Kane,K.P.
  TITLE     The activating Ly49W and inhibitory Ly49G NK cell receptors display
            similar affinities for identical MHC class I ligands
  JOURNAL   Immunogenetics 66 (7-8), 467-477 (2014)
   PUBMED   24797174
  REMARK    GeneRIF: The ectodomain of inhibitory Ly49G of the BALB/c mouse
            strain is highly similar to the Ly49W activating receptor in the
            nonobese diabetic (NOD) mouse.
REFERENCE   5  (bases 1 to 1075)
  AUTHORS   Yamanaka,T., Tosaki,A., Kurosawa,M., Akimoto,K., Hirose,T.,
            Ohno,S., Hattori,N. and Nukina,N.
  TITLE     Loss of aPKClambda in differentiated neurons disrupts the polarity
            complex but does not induce obvious neuronal loss or disorientation
            in mouse brains
  JOURNAL   PLoS One 8 (12), e84036 (2013)
   PUBMED   24391875
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1075)
  AUTHORS   Yokoyama,W.M.
  TITLE     Hybrid resistance and the Ly-49 family of natural killer cell
            receptors
  JOURNAL   J Exp Med 182 (2), 273-277 (1995)
   PUBMED   7629493
  REMARK    Review article
REFERENCE   7  (bases 1 to 1075)
  AUTHORS   Mason,L.H., Yagita,H. and Ortaldo,J.R.
  TITLE     LGL-1: a potential triggering molecule on murine NK cells
  JOURNAL   J Leukoc Biol 55 (3), 362-370 (1994)
   PUBMED   7509843
REFERENCE   8  (bases 1 to 1075)
  AUTHORS   Morse,H.C. 3rd.
  TITLE     Genetic nomenclature for loci controlling surface antigens of mouse
            hemopoietic cells
  JOURNAL   J Immunol 149 (10), 3129-3134 (1992)
   PUBMED   1431091
  REMARK    Review article
            Erratum:[J Immunol 1993 Mar 15;150(6):2563]
REFERENCE   9  (bases 1 to 1075)
  AUTHORS   Wong,S., Freeman,J.D., Kelleher,C., Mager,D. and Takei,F.
  TITLE     Ly-49 multigene family. New members of a superfamily of type II
            membrane proteins with lectin-like domains
  JOURNAL   J Immunol 147 (4), 1417-1423 (1991)
   PUBMED   1869832
REFERENCE   10 (bases 1 to 1075)
  AUTHORS   Yokoyama,W.M., Kehn,P.J., Cohen,D.I. and Shevach,E.M.
  TITLE     Chromosomal location of the Ly-49 (A1, YE1/48) multigene family.
            Genetic association with the NK 1.1 antigen
  JOURNAL   J Immunol 145 (7), 2353-2358 (1990)
   PUBMED   1975828
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            U10094.1.
            
            On Nov 15, 2007 this sequence version replaced NM_014194.4.
            
            Transcript Variant: This variant (2) differs in the 5' and 3' UTR
            and lacks an alternate in-frame exon, compared to variant 1,
            resulting in a shorter protein (isoform 2).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: U10094.1, AK143240.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMN00849374,
                                           SAMN00849375 [ECO:0006172]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1075              U10094.1           1-1075
FEATURES             Location/Qualifiers
     source          1..1075
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="6"
                     /map="6 63.44 cM"
     gene            1..1075
                     /gene="Klra7"
                     /gene_synonym="LGL-1; Ly-49G.1; Ly-49G.2; Ly-49G.3; Ly49g;
                     Ly49G.4; Ly49g1; Ly49g2"
                     /note="killer cell lectin-like receptor, subfamily A,
                     member 7"
                     /db_xref="GeneID:16638"
                     /db_xref="MGI:MGI:101901"
     exon            1..182
                     /gene="Klra7"
                     /gene_synonym="LGL-1; Ly-49G.1; Ly-49G.2; Ly-49G.3; Ly49g;
                     Ly49G.4; Ly49g1; Ly49g2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    41..43
                     /gene="Klra7"
                     /gene_synonym="LGL-1; Ly-49G.1; Ly-49G.2; Ly-49G.3; Ly49g;
                     Ly49G.4; Ly49g1; Ly49g2"
                     /note="upstream in-frame stop codon"
     CDS             71..874
                     /gene="Klra7"
                     /gene_synonym="LGL-1; Ly-49G.1; Ly-49G.2; Ly-49G.3; Ly49g;
                     Ly49G.4; Ly49g1; Ly49g2"
                     /note="isoform 2 is encoded by transcript variant 2;
                     killer cell lectin-like receptor 7; ly-49g; lymphocyte
                     antigen 49g; T-cell surface glycoprotein Ly-49G"
                     /codon_start=1
                     /product="killer cell lectin-like receptor 7 isoform 2"
                     /protein_id="NP_055009.5"
                     /db_xref="CCDS:CCDS39668.1"
                     /db_xref="GeneID:16638"
                     /db_xref="MGI:MGI:101901"
                     /translation="

MSEQEVTYSTVRFHESSRLQKLVRTEEPQRPREACYREYSVPWKLIVIACGILCFLLLVTVALLAITIFQHSQQKHELQETLNCHDNCSPTQSDVNLKDELLRNKSIECRPGNDLLESLSRDQNRWYSETKTFSDSSQHTGRGFEKYWFCYGIKCYYFNMDRKTWSGCKQTCQISSLSLLKIDNEDELKFLQNLAPSDISWIGLSYDNKKKDWVWIDNGPSKLALNTTKYNIRDGLCMSLSKTRLDNGDCDKSYICICGKRLDKFPH"

     misc_feature    188..544
                     /gene="Klra7"
                     /gene_synonym="LGL-1; Ly-49G.1; Ly-49G.2; Ly-49G.3; Ly49g;
                     Ly49G.4; Ly49g1; Ly49g2"
                     /note="Ly49-like protein, N-terminal region; Region: Ly49;
                     pfam08391"
                     /db_xref="CDD:462461"
     misc_feature    503..850
                     /gene="Klra7"
                     /gene_synonym="LGL-1; Ly-49G.1; Ly-49G.2; Ly-49G.3; Ly49g;
                     Ly49G.4; Ly49g1; Ly49g2"
                     /note="C-type lectin-like domain (CTLD) of the type found
                     in natural killer cell receptors (NKRs); Region:
                     CLECT_NK_receptors_like; cd03593"
                     /db_xref="CDD:153063"
     misc_feature    order(665..667,746..748,800..802,806..811)
                     /gene="Klra7"
                     /gene_synonym="LGL-1; Ly-49G.1; Ly-49G.2; Ly-49G.3; Ly49g;
                     Ly49G.4; Ly49g1; Ly49g2"
                     /note="ligand binding surface [chemical binding]; other
                     site"
                     /db_xref="CDD:153063"
     exon            183..272
                     /gene="Klra7"
                     /gene_synonym="LGL-1; Ly-49G.1; Ly-49G.2; Ly-49G.3; Ly49g;
                     Ly49G.4; Ly49g1; Ly49g2"
                     /inference="alignment:Splign:2.1.0"
     exon            273..491
                     /gene="Klra7"
                     /gene_synonym="LGL-1; Ly-49G.1; Ly-49G.2; Ly-49G.3; Ly49g;
                     Ly49G.4; Ly49g1; Ly49g2"
                     /inference="alignment:Splign:2.1.0"
     exon            492..634
                     /gene="Klra7"
                     /gene_synonym="LGL-1; Ly-49G.1; Ly-49G.2; Ly-49G.3; Ly49g;
                     Ly49G.4; Ly49g1; Ly49g2"
                     /inference="alignment:Splign:2.1.0"
     exon            635..738
                     /gene="Klra7"
                     /gene_synonym="LGL-1; Ly-49G.1; Ly-49G.2; Ly-49G.3; Ly49g;
                     Ly49G.4; Ly49g1; Ly49g2"
                     /inference="alignment:Splign:2.1.0"
     exon            739..894
                     /gene="Klra7"
                     /gene_synonym="LGL-1; Ly-49G.1; Ly-49G.2; Ly-49G.3; Ly49g;
                     Ly49G.4; Ly49g1; Ly49g2"
                     /inference="alignment:Splign:2.1.0"
     exon            895..1075
                     /gene="Klra7"
                     /gene_synonym="LGL-1; Ly-49G.1; Ly-49G.2; Ly-49G.3; Ly49g;
                     Ly49G.4; Ly49g1; Ly49g2"
                     /inference="alignment:Splign:2.1.0"
     regulatory      1045..1050
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Klra7"
                     /gene_synonym="LGL-1; Ly-49G.1; Ly-49G.2; Ly-49G.3; Ly49g;
                     Ly49G.4; Ly49g1; Ly49g2"
                     /note="hexamer: AATAAA"
     polyA_site      1065
                     /gene="Klra7"
                     /gene_synonym="LGL-1; Ly-49G.1; Ly-49G.2; Ly-49G.3; Ly49g;
                     Ly49G.4; Ly49g1; Ly49g2"
                     /note="major polyA site"
ORIGIN      

taacatttttcgtagaaaccactcaaggcaccattttaactgagaacatacttcatacatcattcccaagatgagtgagcaggaggtcacttactcaactgtgagatttcatgagtcttcaaggttgcagaaactagtgaggactgaggagcctcaaaggcccagagaagcttgctacagagagtattcagtcccctggaagctcattgtgatagcttgtggaatcctctgtttccttctcctggtaactgttgcattgttggcaataacgatttttcagcatagtcaacaaaaacatgaactacaggaaactctaaattgccacgataactgcagccccacgcaaagtgacgtcaacttgaaggatgaactgctgagaaataagtctatagagtgtaggccaggcaatgatcttctggaatccctcagcagggatcagaacagatggtacagtgaaaccaagactttttcagattcctcacagcacacaggtagaggttttgaaaaatattggttctgttatggtataaaatgttattatttcaacatggacagaaaaacgtggagtggatgtaaacagacctgccagatttccagcttatcccttctgaagatagacaatgaggatgaactgaagttccttcagaacctggctccttcagacatttcctggattggattgtcatatgacaataagaaaaaagattgggtatggattgacaatggcccatctaaacttgccttgaacacaacgaaatataatataagagatggattatgtatgtcgttatctaaaacaagactagacaatggggactgtgataaatcatacatctgtatttgtggtaagagactggataaatttcctcattgactctccaatgagtgtaaaagtgcaaagagagagacaatctggaagattttgggaatgttctctgaaaaatgacatgacagagcagaggacatcttccttccttgtggagactgaacagacctactctggtcccccaaagcttatctgatttatttgtttgcataaactccaataaaagtaaataaagaaccttaataacta

//