LOCUS       NM_009690               2037 bp    mRNA    linear   ROD 20-JUN-2025
DEFINITION  Mus musculus CD5 antigen-like (Cd5l), mRNA.
ACCESSION   NM_009690
VERSION     NM_009690.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 2037)
  AUTHORS   Cardoso,M.S., Goncalves,R., Oliveira,L., Silverio,D., Tellez,E.,
            Paul,T., Sarrias,M.R., Carmo,A.M. and Saraiva,M.
  TITLE     CD5L is upregulated upon infection with Mycobacterium tuberculosis
            with no effect on disease progression
  JOURNAL   Immunology 173 (2), 310-320 (2024)
   PUBMED   38922694
  REMARK    GeneRIF: CD5L is upregulated upon infection with Mycobacterium
            tuberculosis with no effect on disease progression.
REFERENCE   2  (bases 1 to 2037)
  AUTHORS   Oliveira,L., Silva,M.C., Gomes,A.P., Santos,R.F., Cardoso,M.S.,
            Novoa,A., Luche,H., Cavadas,B., Amorim,I., Gartner,F., Malissen,B.,
            Mallo,M. and Carmo,A.M.
  TITLE     CD5L as a promising biological therapeutic for treating sepsis
  JOURNAL   Nat Commun 15 (1), 4119 (2024)
   PUBMED   38750020
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2037)
  AUTHORS   Adams,D.J., Barlas,B., McIntyre,R.E., Salguero,I., van der
            Weyden,L., Barros,A., Vicente,J.R., Karimpour,N., Haider,A.,
            Ranzani,M., Turner,G., Thompson,N.A., Harle,V., Olvera-Leon,R.,
            Robles-Espinoza,C.D., Speak,A.O., Geisler,N., Weninger,W.J.,
            Geyer,S.H., Hewinson,J., Karp,N.A., Fu,B., Yang,F., Kozik,Z.,
            Choudhary,J., Yu,L., van Ruiten,M.S., Rowland,B.D., Lelliott,C.J.,
            Del Castillo Velasco-Herrera,M., Verstraten,R., Bruckner,L.,
            Henssen,A.G., Rooimans,M.A., de Lange,J., Mohun,T.J., Arends,M.J.,
            Kentistou,K.A., Coelho,P.A., Zhao,Y., Zecchini,H., Perry,J.R.B.,
            Jackson,S.P. and Balmus,G.
  CONSRTM   Sanger Mouse Genetics Project
  TITLE     Genetic determinants of micronucleus formation in vivo
  JOURNAL   Nature 627 (8002), 130-136 (2024)
   PUBMED   38355793
REFERENCE   4  (bases 1 to 2037)
  AUTHORS   Yasuda,K., Shimodan,S., Maehara,N., Hirota,A., Iijima,R.,
            Nishijima,A., Mori,H., Toyama,R., Ito,A., Yoshikawa,Y., Arai,S. and
            Miyazaki,T.
  TITLE     AIM/CD5L ameliorates autoimmune arthritis by promoting removal of
            inflammatory DAMPs at the lesions
  JOURNAL   J Autoimmun 142, 103149 (2024)
   PUBMED   38006711
  REMARK    GeneRIF: AIM/CD5L ameliorates autoimmune arthritis by promoting
            removal of inflammatory DAMPs at the lesions.
REFERENCE   5  (bases 1 to 2037)
  AUTHORS   Takimoto-Sato,M., Suzuki,M., Kimura,H., Ge,H., Matsumoto,M.,
            Makita,H., Arai,S., Miyazaki,T., Nishimura,M. and Konno,S.
  TITLE     Apoptosis inhibitor of macrophage (AIM)/CD5L is involved in the
            pathogenesis of COPD
  JOURNAL   Respir Res 24 (1), 201 (2023)
   PUBMED   37592330
  REMARK    GeneRIF: Apoptosis inhibitor of macrophage (AIM)/CD5L is involved
            in the pathogenesis of COPD.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 2037)
  AUTHORS   Guselnikov,S.V., Ershova,S.A., Mechetina,L.V., Najakshin,A.M.,
            Volkova,O.Y., Alabyev,B.Y. and Taranin,A.V.
  TITLE     A family of highly diverse human and mouse genes structurally links
            leukocyte FcR, gp42 and PECAM-1
  JOURNAL   Immunogenetics 54 (2), 87-95 (2002)
   PUBMED   12037601
REFERENCE   7  (bases 1 to 2037)
  AUTHORS   Gebe,J.A., Llewellyn,M., Hoggatt,H. and Aruffo,A.
  TITLE     Molecular cloning, genomic organization and cell-binding
            characteristics of mouse Spalpha
  JOURNAL   Immunology 99 (1), 78-86 (2000)
   PUBMED   10651944
REFERENCE   8  (bases 1 to 2037)
  AUTHORS   Eddleston,J., Murdoch,J.N., Copp,A.J. and Stanier,P.
  TITLE     Physical and transcriptional map of a 3-Mb region of mouse
            chromosome 1 containing the gene for the neural tube defect mutant
            loop-tail (Lp)
  JOURNAL   Genomics 56 (2), 149-159 (1999)
   PUBMED   10051400
REFERENCE   9  (bases 1 to 2037)
  AUTHORS   Miyazaki,T., Hirokami,Y., Matsuhashi,N., Takatsuka,H. and Naito,M.
  TITLE     Increased susceptibility of thymocytes to apoptosis in mice lacking
            AIM, a novel murine macrophage-derived soluble factor belonging to
            the scavenger receptor cysteine-rich domain superfamily
  JOURNAL   J Exp Med 189 (2), 413-422 (1999)
   PUBMED   9892623
REFERENCE   10 (bases 1 to 2037)
  AUTHORS   Iwama,A., Zhang,P., Darlington,G.J., McKercher,S.R., Maki,R. and
            Tenen,D.G.
  TITLE     Use of RDA analysis of knockout mice to identify myeloid genes
            regulated in vivo by PU.1 and C/EBPalpha
  JOURNAL   Nucleic Acids Res 26 (12), 3034-3043 (1998)
   PUBMED   9611252
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK159181.1 and BY582711.1.
            
            On Nov 16, 2007 this sequence version replaced NM_009690.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK159181.1, AK159823.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849374, SAMN00849381
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-2035              AK159181.1         4-2038
            2036-2037           BY582711.1         395-396
FEATURES             Location/Qualifiers
     source          1..2037
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="3"
                     /map="3 38.19 cM"
     gene            1..2037
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /note="CD5 antigen-like"
                     /db_xref="GeneID:11801"
                     /db_xref="MGI:MGI:1334419"
     exon            1..149
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /inference="alignment:Splign:2.1.0"
     CDS             122..1180
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /note="apoptosis inhibitor 6; CT-2; apoptosis inhibitor
                     expressed by macrophages; AIM/Spalpha; Pdp 1/6"
                     /codon_start=1
                     /product="CD5 antigen-like precursor"
                     /protein_id="NP_033820.2"
                     /db_xref="CCDS:CCDS17451.1"
                     /db_xref="GeneID:11801"
                     /db_xref="MGI:MGI:1334419"
                     /translation="

MAPLFNLMLAILSIFVGSCFSESPTKVQLVGGAHRCEGRVEVEHNGQWGTVCDDGWDRRDVAVVCRELNCGAVIQTPRGASYQPPASEQRVLIQGVDCNGTEDTLAQCELNYDVFDCSHEEDAGAQCENPDSDLLFIPEDVRLVDGPGHCQGRVEVLHQSQWSTVCKAGWNLQVSKVVCRQLGCGRALLTYGSCNKNTQGKGPIWMGKMSCSGQEANLRSCLLSRLENNCTHGEDTWMECEDPFELKLVGGDTPCSGRLEVLHKGSWGSVCDDNWGEKEDQVVCKQLGCGKSLHPSPKTRKIYGPGAGRIWLDDVNCSGKEQSLEFCRHRLWGYHDCTHKEDVEVICTDFDV"

     sig_peptide     122..184
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /inference="COORDINATES: ab initio prediction:SignalP:6.0"
     mat_peptide     185..1177
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /product="CD5 antigen-like"
     misc_feature    200..502
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /note="Scavenger receptor Cys-rich; Region: SR;
                     smart00202"
                     /db_xref="CDD:214555"
     misc_feature    416..418
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000269|PubMed:23236605; propagated from
                     UniProtKB/Swiss-Prot (Q9QWK4.3); glycosylation site"
     misc_feature    542..841
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /note="Scavenger receptor Cys-rich; Region: SR;
                     smart00202"
                     /db_xref="CDD:214555"
     misc_feature    806..808
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000269|PubMed:23236605; propagated from
                     UniProtKB/Swiss-Prot (Q9QWK4.3); glycosylation site"
     misc_feature    857..1165
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /note="Scavenger receptor Cys-rich; Region: SR;
                     smart00202"
                     /db_xref="CDD:214555"
     misc_feature    1067..1069
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /note="Not glycosylated.
                     /evidence=ECO:0000269|PubMed:23236605; propagated from
                     UniProtKB/Swiss-Prot (Q9QWK4.3); other site"
     exon            150..185
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /inference="alignment:Splign:2.1.0"
     exon            186..506
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /inference="alignment:Splign:2.1.0"
     exon            507..845
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /inference="alignment:Splign:2.1.0"
     exon            846..1166
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /inference="alignment:Splign:2.1.0"
     exon            1167..2037
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /inference="alignment:Splign:2.1.0"
     regulatory      2015..2020
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /note="hexamer: AATAAA"
     polyA_site      2036
                     /gene="Cd5l"
                     /gene_synonym="1/6; AAC-11; AIM; Api6; CT2; mAIM; Pdp;
                     Sp-alpha"
                     /note="major polyA site"
ORIGIN      

tttgataaagctcctactgcacacaggacctgcctctcttccttattctagtgttcaaaccaaataccactgcctgaggcctacagcctgtctcaccactccatcgtcagctgcctgggccatggctccattgttcaacttgatgctggccatcttgagcatttttgttggatcgtgtttttcagagtctccaaccaaagtgcagctagtgggaggtgcccaccgctgtgaagggcgagtggaggtggaacacaatggccagtgggggactgtgtgtgatgatggctgggaccggcgtgatgtggctgtggtgtgccgagagctcaattgtggagcagtcatccaaaccccgcgtggcgcatcatatcagccaccagcatcagagcaaagagttcttattcaaggggttgactgcaacggaacggaagacacgttggctcaatgtgagctaaattacgatgtttttgactgctcacatgaagaagatgctggggcacagtgtgagaacccagacagtgacctcctcttcattccagaggatgtgcgtctagtagatggcccggggcactgccagggtcgagtggaggtgctccaccagtcccagtggagcactgtgtgtaaagcaggctggaacttacaggtctcaaaggtggtgtgcaggcagctcgggtgtgggcgggcattactgacctacggaagctgcaacaagaatactcagggcaaaggacccatctggatgggcaagatgtcgtgttctggacaagaagcaaaccttcggtcttgccttttgagtcgtttggagaacaactgtacccatggcgaggacacatggatggaatgtgaagatccttttgagctgaagctggtgggaggagacaccccctgctctgggaggttggaggtgctacacaagggttcctggggctctgtctgtgatgacaactggggagaaaaggaggaccaagtggtctgcaagcaactgggttgtgggaagtccctccatccatcccccaaaacccggaaaatctatgggcctggggcaggccgcatctggctggatgacgtcaactgctcagggaaggaacagtctctggagttctgccggcacaggttgtgggggtaccacgactgtacccacaaggaagatgtggaggtgatctgcacagactttgatgtgtgaattggatccctgcttgttcagtgggccctcattctcccagtggttacatcaggctgtgggctttagacacctttccctcagcctcgaaagagtctgaacattgtgttcctatcttgatctcaaggctacacgcccccataatcacctcaagacatgagctgctgagctcccttgctgacctttccagctgccctaggctcactgttcactccttggtgaacagcccccacctttactgtctctccccagcctgcctgcaactcttgggcctgccagagtgagcagctgtacaggccaggactaagacacagcctgtctgtgaacaccactgaggatgtgacaacatgaggaacacttgagagggaatgtgggtagacagattcttggaggcaggagagataatacaattgtttaaatgctttttaaactttgtaacaagtgaagtgatcataataataacacttcactactctgcttctctcagagaaagcagcagggtggtttcctgcagccctcaaatgttacctgttgagttctagatgtctaccccaaacctccatgtttaaagtttgatgtctaatgcaacagtattctgaggtggggccttagggatccaactgcatcatgtggtttgatccctcagtctttatgagtggattaatcactggtgaatcccctgggagatggtagagacttgaggagttgggacctcgttagaagaagaaggtcgttggagtgtgcctttggaaggggctgttttgtccacagcttgaccacctccctgtgtagatgggtcacttgcatatcttcgctactgtgtgtgaattatgctacaataaacatgagtgctcaagtat

//