GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-10-14 09:10:16, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NM_008818                869 bp    mRNA    linear   ROD 27-APR-2025
DEFINITION  Mus musculus reproductive homeobox 5 (Rhox5), mRNA.
ACCESSION   NM_008818
VERSION     NM_008818.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 869)
  AUTHORS   Oh,Y., Kasu,M., Bottoms,C.J., Douglas,J.C., Sekulovski,N.,
            Hayashi,K. and MacLean Ii,J.A.
  TITLE     Rhox8 homeobox gene ablation leads to rete testis abnormality and
            male subfertility in micedagger
  JOURNAL   Biol Reprod 109 (4), 520-532 (2023)
   PUBMED   37471646
REFERENCE   2  (bases 1 to 869)
  AUTHORS   Bhardwaj,A., Sohni,A., Lou,C.H., De Gendt,K., Zhang,F., Kim,E.,
            Subbarayalu,P., Chan,W., Kerkhofs,S., Claessens,F., Kimmins,S.,
            Rao,M.K., Meistrich,M. and Wilkinson,M.F.
  TITLE     Concordant Androgen-Regulated Expression of Divergent Rhox5
            Promoters in Sertoli Cells
  JOURNAL   Endocrinology 163 (1) (2022)
   PUBMED   34902009
  REMARK    GeneRIF: Concordant Androgen-Regulated Expression of Divergent
            Rhox5 Promoters in Sertoli Cells.
REFERENCE   3  (bases 1 to 869)
  AUTHORS   Perea-Gomez,A., Cases,O., Lelievre,V., Pulina,M.V., Collignon,J.,
            Hadjantonakis,A.K. and Kozyraki,R.
  TITLE     Loss of Cubilin, the intrinsic factor-vitamin B12 receptor, impairs
            visceral endoderm endocytosis and endodermal patterning in the
            mouse
  JOURNAL   Sci Rep 9 (1), 10168 (2019)
   PUBMED   31308417
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 869)
  AUTHORS   Nowotschin,S., Setty,M., Kuo,Y.Y., Liu,V., Garg,V., Sharma,R.,
            Simon,C.S., Saiz,N., Gardner,R., Boutet,S.C., Church,D.M.,
            Hoodless,P.A., Hadjantonakis,A.K. and Pe'er,D.
  TITLE     The emergent landscape of the mouse gut endoderm at single-cell
            resolution
  JOURNAL   Nature 569 (7756), 361-367 (2019)
   PUBMED   30959515
REFERENCE   5  (bases 1 to 869)
  AUTHORS   Borensztein,M., Syx,L., Ancelin,K., Diabangouaya,P., Picard,C.,
            Liu,T., Liang,J.B., Vassilev,I., Galupa,R., Servant,N.,
            Barillot,E., Surani,A., Chen,C.J. and Heard,E.
  TITLE     Xist-dependent imprinted X inactivation and the early developmental
            consequences of its failure
  JOURNAL   Nat Struct Mol Biol 24 (3), 226-233 (2017)
   PUBMED   28134930
REFERENCE   6  (bases 1 to 869)
  AUTHORS   Lin,T.P., Labosky,P.A., Grabel,L.B., Kozak,C.A., Pitman,J.L.,
            Kleeman,J. and MacLeod,C.L.
  TITLE     The Pem homeobox gene is X-linked and exclusively expressed in
            extraembryonic tissues during early murine development
  JOURNAL   Dev Biol 166 (1), 170-179 (1994)
   PUBMED   7958444
REFERENCE   7  (bases 1 to 869)
  AUTHORS   Wilkinson,M.F., Kleeman,J., Richards,J. and MacLeod,C.L.
  TITLE     A novel oncofetal gene is expressed in a stage-specific manner in
            murine embryonic development
  JOURNAL   Dev Biol 146 (1), 263 (1991)
   PUBMED   1840518
  REMARK    Correction to:[Dev Biol. 1990 Oct;141(2):451-5. doi:
            10.1016/0012-1606(90)90400-d. PMID: 2210045]
REFERENCE   8  (bases 1 to 869)
  AUTHORS   Rayle,R.E.
  TITLE     The oncofetal gene Pem specifies a divergent paired class
            homeodomain
  JOURNAL   Dev Biol 146 (1), 255-257 (1991)
   PUBMED   1676380
REFERENCE   9  (bases 1 to 869)
  AUTHORS   Sasaki,A.W., Doskow,J., MacLeod,C.L., Rogers,M.B., Gudas,L.J. and
            Wilkinson,M.F.
  TITLE     The oncofetal gene Pem encodes a homeodomain and is regulated in
            primordial and pre-muscle stem cells
  JOURNAL   Mech Dev 34 (2-3), 155-164 (1991)
   PUBMED   1680379
REFERENCE   10 (bases 1 to 869)
  AUTHORS   Wilkinson,M.F., Kleeman,J., Richards,J. and MacLeod,C.L.
  TITLE     A novel oncofetal gene is expressed in a stage-specific manner in
            murine embryonic development
  JOURNAL   Dev Biol 141 (2), 451-455 (1990)
   PUBMED   2210045
  REMARK    Erratum:[Dev Biol. 1991 Jul;146(1):263. doi:
            10.1016/0012-1606(91)90469-j. PMID: 1840518]
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK146449.1 and DQ058642.1.
            
            On Apr 7, 2006 this sequence version replaced NM_008818.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            CDS exon combination :: AK146379.1, AK146393.1 [ECO:0000331]
            RNAseq introns       :: single sample supports all introns
                                    SAMN00849384, SAMN00849390 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-826               AK146449.1         7-832
            827-869             DQ058642.1         811-853
FEATURES             Location/Qualifiers
     source          1..869
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="X"
                     /map="X"
     gene            1..869
                     /gene="Rhox5"
                     /gene_synonym="Pem"
                     /note="reproductive homeobox 5"
                     /db_xref="GeneID:18617"
                     /db_xref="MGI:MGI:97538"
     exon            1..50
                     /gene="Rhox5"
                     /gene_synonym="Pem"
                     /inference="alignment:Splign:2.1.0"
     exon            51..119
                     /gene="Rhox5"
                     /gene_synonym="Pem"
                     /inference="alignment:Splign:2.1.0"
     exon            120..201
                     /gene="Rhox5"
                     /gene_synonym="Pem"
                     /inference="alignment:Splign:2.1.0"
     CDS             123..755
                     /gene="Rhox5"
                     /gene_synonym="Pem"
                     /note="placentae and embryos oncofetal; reproductive
                     homeobox on X chromosome, 5; homeobox protein Pem;
                     reproductive homeobox on chromosome X 5; placenta and
                     embryonic expression protein"
                     /codon_start=1
                     /product="homeobox protein Rhox5"
                     /protein_id="NP_032844.2"
                     /db_xref="CCDS:CCDS57752.1"
                     /db_xref="GeneID:18617"
                     /db_xref="MGI:MGI:97538"
                     /translation="
MEAEGSSRKVTRLLRLGVKEDSEEQHDVKAEAFFQAGEGRDEQGAQGQPGVGAVGTEGEGEELNGGKGHFGPGAPGPMGDGDKDSGTRAGGVEQEQNEPVAEGTESQENGNPGGRQMPLQGSRFAQHRLRELESILQRTNSFDVPREDLDRLMDACVSRVQNWFKIRRAAARRNRRRATPVPEHFRGTFECPACRGVRWGERCPFATPRF"
     misc_feature    123..479
                     /gene="Rhox5"
                     /gene_synonym="Pem"
                     /note="propagated from UniProtKB/Swiss-Prot (P52651.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    489..617
                     /gene="Rhox5"
                     /gene_synonym="Pem"
                     /note="Homeodomain; Region: HOX; smart00389"
                     /db_xref="CDD:197696"
     exon            202..559
                     /gene="Rhox5"
                     /gene_synonym="Pem"
                     /inference="alignment:Splign:2.1.0"
     exon            560..605
                     /gene="Rhox5"
                     /gene_synonym="Pem"
                     /inference="alignment:Splign:2.1.0"
     exon            606..869
                     /gene="Rhox5"
                     /gene_synonym="Pem"
                     /inference="alignment:Splign:2.1.0"
     regulatory      806..811
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Rhox5"
                     /gene_synonym="Pem"
                     /note="hexamer: AATAAA"
     polyA_site      828
                     /gene="Rhox5"
                     /gene_synonym="Pem"
                     /note="major polyA site"
ORIGIN      
gaagagacagaagtcgccatactttggagagagaagagccaaacagccatctccctgcacagtccttcaagctcacctcctgccttccgtggacaagaggaagcacaaagaatcatccaggtatggaagctgagggttccagccgcaaggtcaccaggctactccgcctgggagtcaaggaagactcggaagaacagcatgatgtgaaagcagaggctttcttccaggctggagaggggagagatgagcaaggtgcacagggccagcctggagtgggagcggtgggaacagaaggcgaaggagaagaattaaatggaggaaaaggccactttggtcctggtgctcctggtcctatgggtgatggggacaaggatagtggcaccagggctggtggtgtggagcaggaacaaaatgagccagttgctgagggcactgagagccaggagaatggaaatcctgggggtaggcagatgcccctccagggctctaggttcgcccagcatcgactgagggaactggagtccattttgcagcgcactaattcctttgatgtcccaagggaggatcttgatagactgatggatgcctgtgtgtccagagtgcagaattggtttaagatcaggagggctgcggccagaagaaacaggaggagggcaacaccagtccctgaacattttagaggaacattcgagtgtcctgcttgtcgtggagtgagatggggagaaagatgcccttttgcgacaccgagattttgatttgatcacatatgccggctatgacagcccttacttttcaagaattcagcaataaagaggtggattcccagtatgtttgttccattacctctatgattattaaaatattgatac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]