ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-18 22:06:26, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_001421945 1892 bp mRNA linear ROD 01-MAY-2025
DEFINITION Mus musculus CWC22 spliceosome-associated protein (Cwc22),
transcript variant 17, mRNA.
ACCESSION NM_001421945
VERSION NM_001421945.1
KEYWORDS RefSeq.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE 1 (bases 1 to 1892)
AUTHORS Adams,D.J., Barlas,B., McIntyre,R.E., Salguero,I., van der
Weyden,L., Barros,A., Vicente,J.R., Karimpour,N., Haider,A.,
Ranzani,M., Turner,G., Thompson,N.A., Harle,V., Olvera-Leon,R.,
Robles-Espinoza,C.D., Speak,A.O., Geisler,N., Weninger,W.J.,
Geyer,S.H., Hewinson,J., Karp,N.A., Fu,B., Yang,F., Kozik,Z.,
Choudhary,J., Yu,L., van Ruiten,M.S., Rowland,B.D., Lelliott,C.J.,
Del Castillo Velasco-Herrera,M., Verstraten,R., Bruckner,L.,
Henssen,A.G., Rooimans,M.A., de Lange,J., Mohun,T.J., Arends,M.J.,
Kentistou,K.A., Coelho,P.A., Zhao,Y., Zecchini,H., Perry,J.R.B.,
Jackson,S.P. and Balmus,G.
CONSRTM Sanger Mouse Genetics Project
TITLE Genetic determinants of micronucleus formation in vivo
JOURNAL Nature 627 (8002), 130-136 (2024)
PUBMED 38355793
REFERENCE 2 (bases 1 to 1892)
AUTHORS Song,Y., Wang,Z.Y., Luo,J., Han,W.C., Wang,X.Y., Yin,C., Zhao,W.N.,
Hu,S.W., Zhang,Q., Li,Y.Q. and Cao,J.L.
TITLE CWC22-Mediated Alternative Splicing of Spp1 Regulates Nociception
in Inflammatory Pain
JOURNAL Neuroscience 535, 50-62 (2023)
PUBMED 37838283
REMARK GeneRIF: CWC22-Mediated Alternative Splicing of Spp1 Regulates
Nociception in Inflammatory Pain.
REFERENCE 3 (bases 1 to 1892)
AUTHORS Kobayashi,M., Chandrasekhar,A., Cheng,C., Martinez,J.A., Ng,H., de
la Hoz,C. and Zochodne,D.W.
TITLE Diabetic polyneuropathy, sensory neurons, nuclear structure and
spliceosome alterations: a role for CWC22
JOURNAL Dis Model Mech 10 (3), 215-224 (2017)
PUBMED 28250049
REMARK GeneRIF: These findings identify subtle but significant alterations
in spliceosome structure and function, including dysregulated Cajal
bodies and CWC22 overexpression, in diabetic sensory neurons that
offer new ideas regarding diabetic sensory neurodegeneration in
polyneuropathy.
REFERENCE 4 (bases 1 to 1892)
AUTHORS Morgan,A.P., Holt,J.M., McMullan,R.C., Bell,T.A., Clayshulte,A.M.,
Didion,J.P., Yadgary,L., Thybert,D., Odom,D.T., Flicek,P.,
McMillan,L. and de Villena,F.P.
TITLE The Evolutionary Fates of a Large Segmental Duplication in Mouse
JOURNAL Genetics 204 (1), 267-285 (2016)
PUBMED 27371833
REMARK GeneRIF: Authors have reconstructed the origin and history of a
127-kbp segmental duplication, R2d, in the house mouse (Mus
musculus). R2d contains a single protein-coding gene, Cwc22 De novo
assembly of both the ancestral (R2d1) and the derived (R2d2) copies
reveals that they have been subject to nonallelic gene conversion
events spanning tens of kilobases.
REFERENCE 5 (bases 1 to 1892)
AUTHORS Pezer,Z., Harr,B., Teschke,M., Babiker,H. and Tautz,D.
TITLE Divergence patterns of genic copy number variation in natural
populations of the house mouse (Mus musculus domesticus) reveal
three conserved genes with major population-specific expansions
JOURNAL Genome Res 25 (8), 1114-1124 (2015)
PUBMED 26149421
REMARK GeneRIF: Study showed major differences in gene copy number in
natural populations. CWC22, SFI1, and HJURP are highly conserved
genes with the most copy-number variation. They all exhibit
population-specific expansion patterns, perhaps for local
adaptations.
REFERENCE 6 (bases 1 to 1892)
AUTHORS Osipovich,A.B., Long,Q., Manduchi,E., Gangula,R., Hipkens,S.B.,
Schneider,J., Okubo,T., Stoeckert,C.J. Jr., Takada,S. and
Magnuson,M.A.
TITLE Insm1 promotes endocrine cell differentiation by modulating the
expression of a network of genes that includes Neurog3 and Ripply3
JOURNAL Development 141 (15), 2939-2949 (2014)
PUBMED 25053427
REFERENCE 7 (bases 1 to 1892)
AUTHORS Tamplin,O.J., Kinzel,D., Cox,B.J., Bell,C.E., Rossant,J. and
Lickert,H.
TITLE Microarray analysis of Foxa2 mutant mouse embryos reveals novel
gene expression and inductive roles for the gastrula organizer and
its derivatives
JOURNAL BMC Genomics 9, 511 (2008)
PUBMED 18973680
REMARK Publication Status: Online-Only
REFERENCE 8 (bases 1 to 1892)
AUTHORS Bulfone,A., Carotenuto,P., Faedo,A., Aglio,V., Garzia,L.,
Bello,A.M., Basile,A., Andre,A., Cocchia,M., Guardiola,O.,
Ballabio,A., Rubenstein,J.L. and Zollo,M.
TITLE Telencephalic embryonic subtractive sequences: a unique collection
of neurodevelopmental genes
JOURNAL J Neurosci 25 (33), 7586-7600 (2005)
PUBMED 16107646
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AL928791.11 and AL928915.24.
##Evidence-Data-START##
Transcript exon combination :: SRR7345562.3553631.1,
SRR17784643.178350.1 [ECO:0000332]
RNAseq introns :: mixed sample support SAMN00849374,
SAMN00849375 [ECO:0006172]
##Evidence-Data-END##
COMPLETENESS: full length.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-45 AL928791.11 13473-13517 c
46-175 AL928791.11 3916-4045 c
176-243 AL928915.24 143901-143968 c
244-354 AL928915.24 142637-142747 c
355-597 AL928915.24 140458-140700 c
598-1892 AL928915.24 137244-138538 c
FEATURES Location/Qualifiers
source 1..1892
/organism="Mus musculus"
/mol_type="mRNA"
/strain="C57BL/6"
/db_xref="taxon:10090"
/chromosome="2"
/map="2 46.45 cM"
gene 1..1892
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
/note="CWC22 spliceosome-associated protein"
/db_xref="GeneID:80744"
/db_xref="MGI:MGI:2136773"
exon 1..45
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
/inference="alignment:Splign:2.1.0"
exon 46..175
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
/inference="alignment:Splign:2.1.0"
misc_feature 137..139
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
/note="upstream in-frame stop codon"
CDS 149..730
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
/note="isoform 11 is encoded by transcript variant 17;
pre-mRNA-splicing factor CWC22 homolog; nucampholin
homolog; CWC22 spliceosome-associated protein homolog"
/codon_start=1
/product="pre-mRNA-splicing factor CWC22 homolog isoform
11"
/protein_id="NP_001408874.1"
/db_xref="GeneID:80744"
/db_xref="MGI:MGI:2136773"
/translation="
MKSSVAHMKQSSGHNRRETHSSYRRSSSPEDRYTEQERSPRDRGYSDYSRSDYERSRRGYSYDDSMESRSRDREKRRERERDADHRKRSRKSPSPDRSPARGGGQSSPQEEPTWKKKKDELDPLLTRTGGAYIPPAKLRMMQEQITDKSSLAYQRMSWEALKKSINGLINKVNISNISIIIQELLQENIVRGR"
misc_feature 173..>610
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
/note="U2 snRNP auxilliary factor, large subunit, splicing
factor; Region: U2AF_lg; TIGR01642"
/db_xref="CDD:273727"
misc_feature 263..265
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:Q9HCG8; propagated from
UniProtKB/Swiss-Prot (Q8C5N3.1); phosphorylation site"
misc_feature 329..331
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:Q9HCG8; propagated from
UniProtKB/Swiss-Prot (Q8C5N3.1); phosphorylation site"
misc_feature 467..469
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
/note="Phosphoserine.
/evidence=ECO:0007744|PubMed:17242355,
ECO:0007744|PubMed:21183079; propagated from
UniProtKB/Swiss-Prot (Q8C5N3.1); phosphorylation site"
exon 176..243
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
/inference="alignment:Splign:2.1.0"
exon 244..354
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
/inference="alignment:Splign:2.1.0"
exon 355..597
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
/inference="alignment:Splign:2.1.0"
exon 598..1892
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
/inference="alignment:Splign:2.1.0"
regulatory 908..913
/regulatory_class="polyA_signal_sequence"
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
/note="hexamer: AATAAA"
polyA_site 927
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
regulatory 1873..1878
/regulatory_class="polyA_signal_sequence"
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
/note="hexamer: AATAAA"
polyA_site 1892
/gene="Cwc22"
/gene_synonym="B230213M24; mKIAA1604"
/note="major polyA site"
ORIGIN
gaactgacgctcttccggtatgatggcggcgcggtggagctttaggtgacgtgtagagacagaaaaagaaaactgtcgaggaactcaaaccactgagcacgtgtcacttgaatgaacctgaagaatctggggcagctgacagcagaaaatgaaaagtagtgtggcacacatgaagcagtcctctggtcacaacagaagggagacccacagttcataccgccggagctcctccccagaagacagatacacagagcaagagcggtccccccgggatagaggttactctgattacagccggtcagactatgagcgatctagaagaggatactcttacgatgacagcatggaatcacgaagtagggaccgagaaaaacgcagagagagagagagagatgcagatcatcggaaacggtcccggaaatcgccatcccctgacaggagtccagcccgaggcggagggcagagttctcctcaggaggaaccgacatggaagaagaagaaggatgagctggacccgctgctcacccgcactgggggagcgtatatccctcctgcgaagctcaggatgatgcaggagcagatcacagataaaagcagcttagcatatcagaggatgagctgggaggctctgaagaaatccatcaatggtctcatcaacaaggtcaacatctctaatataagcattattatccaagagctccttcaagagaacattgtcagagggaggtaagtagccagaaccttgtatatttcatagtaactcattgaaagaagcataatgtctctgaacagtaagcattgatttgttatgctacttcattttaaaggtttttgtgaatgtttatttgaaatacagttctttttaaatgtaggctgttaaataacttaaaccatgttgttcaagagtaataaaccagtgcttttggagatttgctatcatgccatagttttgcgtggatatttattgaatgtctccaataatttaaatccatgaggcataacaattattaaaatatgctatttcaaaccactttatttttttttaattggcataaaatctttataaattttttagtaacagtgtgctactttaatatgtatattctgtgttgtcatgtgtcaggatttctttaattttttttaatgctgagtggcattccattgtgtaaatgacattccctgtctgtcattgacatggcactcactccctttggctcttgtgggtaatggtgtgggggtgtgcggtgtagctcagaggcttagtcttccctgctggctgcactgctgcgcattcctgttcacagtccctgtgtgcttcctgttctctgcctccttggaaacgctcacctttggttatttttatggcagccattatttaggtatgagacgatacatcgtgtgccttgactctgtattcgtctgataggtgatgcttcatgtcagcatgtctgtatcgtcttgaaatgtctagttagatgttttgtcaggctttgaaactaatgttttattactttggcagatattttggatattagctccttaagagataaacggcttgcagatcctttctcccatctgtatttgtctcttggcttcttgcatggtttctagcactgtccagagccttttagatcagtgcagtgccatttgtcaagttttcttgggttatttagttctgtttagaaatgtgtcaatccaggcagatattgtcaagcttccctcctggaagttgtacagattctgtttgttaatcagtttagattgctttgtgtgtgttgcgtaagattaaagtatgtttttatttctctgcatgttggcatctggctttcctatcactttggaacacattgcctttatgtcaaaatacaattaaataaaaatgtatgaattta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]