GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-18 22:06:26, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_001421945            1892 bp    mRNA    linear   ROD 01-MAY-2025
DEFINITION  Mus musculus CWC22 spliceosome-associated protein (Cwc22),
            transcript variant 17, mRNA.
ACCESSION   NM_001421945
VERSION     NM_001421945.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1892)
  AUTHORS   Adams,D.J., Barlas,B., McIntyre,R.E., Salguero,I., van der
            Weyden,L., Barros,A., Vicente,J.R., Karimpour,N., Haider,A.,
            Ranzani,M., Turner,G., Thompson,N.A., Harle,V., Olvera-Leon,R.,
            Robles-Espinoza,C.D., Speak,A.O., Geisler,N., Weninger,W.J.,
            Geyer,S.H., Hewinson,J., Karp,N.A., Fu,B., Yang,F., Kozik,Z.,
            Choudhary,J., Yu,L., van Ruiten,M.S., Rowland,B.D., Lelliott,C.J.,
            Del Castillo Velasco-Herrera,M., Verstraten,R., Bruckner,L.,
            Henssen,A.G., Rooimans,M.A., de Lange,J., Mohun,T.J., Arends,M.J.,
            Kentistou,K.A., Coelho,P.A., Zhao,Y., Zecchini,H., Perry,J.R.B.,
            Jackson,S.P. and Balmus,G.
  CONSRTM   Sanger Mouse Genetics Project
  TITLE     Genetic determinants of micronucleus formation in vivo
  JOURNAL   Nature 627 (8002), 130-136 (2024)
   PUBMED   38355793
REFERENCE   2  (bases 1 to 1892)
  AUTHORS   Song,Y., Wang,Z.Y., Luo,J., Han,W.C., Wang,X.Y., Yin,C., Zhao,W.N.,
            Hu,S.W., Zhang,Q., Li,Y.Q. and Cao,J.L.
  TITLE     CWC22-Mediated Alternative Splicing of Spp1 Regulates Nociception
            in Inflammatory Pain
  JOURNAL   Neuroscience 535, 50-62 (2023)
   PUBMED   37838283
  REMARK    GeneRIF: CWC22-Mediated Alternative Splicing of Spp1 Regulates
            Nociception in Inflammatory Pain.
REFERENCE   3  (bases 1 to 1892)
  AUTHORS   Kobayashi,M., Chandrasekhar,A., Cheng,C., Martinez,J.A., Ng,H., de
            la Hoz,C. and Zochodne,D.W.
  TITLE     Diabetic polyneuropathy, sensory neurons, nuclear structure and
            spliceosome alterations: a role for CWC22
  JOURNAL   Dis Model Mech 10 (3), 215-224 (2017)
   PUBMED   28250049
  REMARK    GeneRIF: These findings identify subtle but significant alterations
            in spliceosome structure and function, including dysregulated Cajal
            bodies and CWC22 overexpression, in diabetic sensory neurons that
            offer new ideas regarding diabetic sensory neurodegeneration in
            polyneuropathy.
REFERENCE   4  (bases 1 to 1892)
  AUTHORS   Morgan,A.P., Holt,J.M., McMullan,R.C., Bell,T.A., Clayshulte,A.M.,
            Didion,J.P., Yadgary,L., Thybert,D., Odom,D.T., Flicek,P.,
            McMillan,L. and de Villena,F.P.
  TITLE     The Evolutionary Fates of a Large Segmental Duplication in Mouse
  JOURNAL   Genetics 204 (1), 267-285 (2016)
   PUBMED   27371833
  REMARK    GeneRIF: Authors have reconstructed the origin and history of a
            127-kbp segmental duplication, R2d, in the house mouse (Mus
            musculus). R2d contains a single protein-coding gene, Cwc22 De novo
            assembly of both the ancestral (R2d1) and the derived (R2d2) copies
            reveals that they have been subject to nonallelic gene conversion
            events spanning tens of kilobases.
REFERENCE   5  (bases 1 to 1892)
  AUTHORS   Pezer,Z., Harr,B., Teschke,M., Babiker,H. and Tautz,D.
  TITLE     Divergence patterns of genic copy number variation in natural
            populations of the house mouse (Mus musculus domesticus) reveal
            three conserved genes with major population-specific expansions
  JOURNAL   Genome Res 25 (8), 1114-1124 (2015)
   PUBMED   26149421
  REMARK    GeneRIF: Study showed major differences in gene copy number in
            natural populations. CWC22, SFI1, and HJURP are highly conserved
            genes with the most copy-number variation. They all exhibit
            population-specific expansion patterns, perhaps for local
            adaptations.
REFERENCE   6  (bases 1 to 1892)
  AUTHORS   Osipovich,A.B., Long,Q., Manduchi,E., Gangula,R., Hipkens,S.B.,
            Schneider,J., Okubo,T., Stoeckert,C.J. Jr., Takada,S. and
            Magnuson,M.A.
  TITLE     Insm1 promotes endocrine cell differentiation by modulating the
            expression of a network of genes that includes Neurog3 and Ripply3
  JOURNAL   Development 141 (15), 2939-2949 (2014)
   PUBMED   25053427
REFERENCE   7  (bases 1 to 1892)
  AUTHORS   Tamplin,O.J., Kinzel,D., Cox,B.J., Bell,C.E., Rossant,J. and
            Lickert,H.
  TITLE     Microarray analysis of Foxa2 mutant mouse embryos reveals novel
            gene expression and inductive roles for the gastrula organizer and
            its derivatives
  JOURNAL   BMC Genomics 9, 511 (2008)
   PUBMED   18973680
  REMARK    Publication Status: Online-Only
REFERENCE   8  (bases 1 to 1892)
  AUTHORS   Bulfone,A., Carotenuto,P., Faedo,A., Aglio,V., Garzia,L.,
            Bello,A.M., Basile,A., Andre,A., Cocchia,M., Guardiola,O.,
            Ballabio,A., Rubenstein,J.L. and Zollo,M.
  TITLE     Telencephalic embryonic subtractive sequences: a unique collection
            of neurodevelopmental genes
  JOURNAL   J Neurosci 25 (33), 7586-7600 (2005)
   PUBMED   16107646
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL928791.11 and AL928915.24.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR7345562.3553631.1,
                                           SRR17784643.178350.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMN00849374,
                                           SAMN00849375 [ECO:0006172]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-45                AL928791.11        13473-13517         c
            46-175              AL928791.11        3916-4045           c
            176-243             AL928915.24        143901-143968       c
            244-354             AL928915.24        142637-142747       c
            355-597             AL928915.24        140458-140700       c
            598-1892            AL928915.24        137244-138538       c
FEATURES             Location/Qualifiers
     source          1..1892
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="2"
                     /map="2 46.45 cM"
     gene            1..1892
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
                     /note="CWC22 spliceosome-associated protein"
                     /db_xref="GeneID:80744"
                     /db_xref="MGI:MGI:2136773"
     exon            1..45
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
                     /inference="alignment:Splign:2.1.0"
     exon            46..175
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    137..139
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
                     /note="upstream in-frame stop codon"
     CDS             149..730
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
                     /note="isoform 11 is encoded by transcript variant 17;
                     pre-mRNA-splicing factor CWC22 homolog; nucampholin
                     homolog; CWC22 spliceosome-associated protein homolog"
                     /codon_start=1
                     /product="pre-mRNA-splicing factor CWC22 homolog isoform
                     11"
                     /protein_id="NP_001408874.1"
                     /db_xref="GeneID:80744"
                     /db_xref="MGI:MGI:2136773"
                     /translation="
MKSSVAHMKQSSGHNRRETHSSYRRSSSPEDRYTEQERSPRDRGYSDYSRSDYERSRRGYSYDDSMESRSRDREKRRERERDADHRKRSRKSPSPDRSPARGGGQSSPQEEPTWKKKKDELDPLLTRTGGAYIPPAKLRMMQEQITDKSSLAYQRMSWEALKKSINGLINKVNISNISIIIQELLQENIVRGR"
     misc_feature    173..>610
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
                     /note="U2 snRNP auxilliary factor, large subunit, splicing
                     factor; Region: U2AF_lg; TIGR01642"
                     /db_xref="CDD:273727"
     misc_feature    263..265
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9HCG8; propagated from
                     UniProtKB/Swiss-Prot (Q8C5N3.1); phosphorylation site"
     misc_feature    329..331
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9HCG8; propagated from
                     UniProtKB/Swiss-Prot (Q8C5N3.1); phosphorylation site"
     misc_feature    467..469
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:17242355,
                     ECO:0007744|PubMed:21183079; propagated from
                     UniProtKB/Swiss-Prot (Q8C5N3.1); phosphorylation site"
     exon            176..243
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
                     /inference="alignment:Splign:2.1.0"
     exon            244..354
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
                     /inference="alignment:Splign:2.1.0"
     exon            355..597
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
                     /inference="alignment:Splign:2.1.0"
     exon            598..1892
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
                     /inference="alignment:Splign:2.1.0"
     regulatory      908..913
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
                     /note="hexamer: AATAAA"
     polyA_site      927
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
     regulatory      1873..1878
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
                     /note="hexamer: AATAAA"
     polyA_site      1892
                     /gene="Cwc22"
                     /gene_synonym="B230213M24; mKIAA1604"
                     /note="major polyA site"
ORIGIN      
gaactgacgctcttccggtatgatggcggcgcggtggagctttaggtgacgtgtagagacagaaaaagaaaactgtcgaggaactcaaaccactgagcacgtgtcacttgaatgaacctgaagaatctggggcagctgacagcagaaaatgaaaagtagtgtggcacacatgaagcagtcctctggtcacaacagaagggagacccacagttcataccgccggagctcctccccagaagacagatacacagagcaagagcggtccccccgggatagaggttactctgattacagccggtcagactatgagcgatctagaagaggatactcttacgatgacagcatggaatcacgaagtagggaccgagaaaaacgcagagagagagagagagatgcagatcatcggaaacggtcccggaaatcgccatcccctgacaggagtccagcccgaggcggagggcagagttctcctcaggaggaaccgacatggaagaagaagaaggatgagctggacccgctgctcacccgcactgggggagcgtatatccctcctgcgaagctcaggatgatgcaggagcagatcacagataaaagcagcttagcatatcagaggatgagctgggaggctctgaagaaatccatcaatggtctcatcaacaaggtcaacatctctaatataagcattattatccaagagctccttcaagagaacattgtcagagggaggtaagtagccagaaccttgtatatttcatagtaactcattgaaagaagcataatgtctctgaacagtaagcattgatttgttatgctacttcattttaaaggtttttgtgaatgtttatttgaaatacagttctttttaaatgtaggctgttaaataacttaaaccatgttgttcaagagtaataaaccagtgcttttggagatttgctatcatgccatagttttgcgtggatatttattgaatgtctccaataatttaaatccatgaggcataacaattattaaaatatgctatttcaaaccactttatttttttttaattggcataaaatctttataaattttttagtaacagtgtgctactttaatatgtatattctgtgttgtcatgtgtcaggatttctttaattttttttaatgctgagtggcattccattgtgtaaatgacattccctgtctgtcattgacatggcactcactccctttggctcttgtgggtaatggtgtgggggtgtgcggtgtagctcagaggcttagtcttccctgctggctgcactgctgcgcattcctgttcacagtccctgtgtgcttcctgttctctgcctccttggaaacgctcacctttggttatttttatggcagccattatttaggtatgagacgatacatcgtgtgccttgactctgtattcgtctgataggtgatgcttcatgtcagcatgtctgtatcgtcttgaaatgtctagttagatgttttgtcaggctttgaaactaatgttttattactttggcagatattttggatattagctccttaagagataaacggcttgcagatcctttctcccatctgtatttgtctcttggcttcttgcatggtttctagcactgtccagagccttttagatcagtgcagtgccatttgtcaagttttcttgggttatttagttctgtttagaaatgtgtcaatccaggcagatattgtcaagcttccctcctggaagttgtacagattctgtttgttaatcagtttagattgctttgtgtgtgttgcgtaagattaaagtatgtttttatttctctgcatgttggcatctggctttcctatcactttggaacacattgcctttatgtcaaaatacaattaaataaaaatgtatgaattta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]