2025-07-16 08:04:58, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001421945 1892 bp mRNA linear ROD 02-MAY-2024 DEFINITION Mus musculus CWC22 spliceosome-associated protein (Cwc22), transcript variant 17, mRNA. ACCESSION NM_001421945 VERSION NM_001421945.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1892) AUTHORS Adams,D.J., Barlas,B., McIntyre,R.E., Salguero,I., van der Weyden,L., Barros,A., Vicente,J.R., Karimpour,N., Haider,A., Ranzani,M., Turner,G., Thompson,N.A., Harle,V., Olvera-Leon,R., Robles-Espinoza,C.D., Speak,A.O., Geisler,N., Weninger,W.J., Geyer,S.H., Hewinson,J., Karp,N.A., Fu,B., Yang,F., Kozik,Z., Choudhary,J., Yu,L., van Ruiten,M.S., Rowland,B.D., Lelliott,C.J., Del Castillo Velasco-Herrera,M., Verstraten,R., Bruckner,L., Henssen,A.G., Rooimans,M.A., de Lange,J., Mohun,T.J., Arends,M.J., Kentistou,K.A., Coelho,P.A., Zhao,Y., Zecchini,H., Perry,J.R.B., Jackson,S.P. and Balmus,G. CONSRTM Sanger Mouse Genetics Project TITLE Genetic determinants of micronucleus formation in vivo JOURNAL Nature 627 (8002), 130-136 (2024) PUBMED 38355793 REFERENCE 2 (bases 1 to 1892) AUTHORS Song,Y., Wang,Z.Y., Luo,J., Han,W.C., Wang,X.Y., Yin,C., Zhao,W.N., Hu,S.W., Zhang,Q., Li,Y.Q. and Cao,J.L. TITLE CWC22-Mediated Alternative Splicing of Spp1 Regulates Nociception in Inflammatory Pain JOURNAL Neuroscience 535, 50-62 (2023) PUBMED 37838283 REMARK GeneRIF: CWC22-Mediated Alternative Splicing of Spp1 Regulates Nociception in Inflammatory Pain. REFERENCE 3 (bases 1 to 1892) AUTHORS Kobayashi,M., Chandrasekhar,A., Cheng,C., Martinez,J.A., Ng,H., de la Hoz,C. and Zochodne,D.W. TITLE Diabetic polyneuropathy, sensory neurons, nuclear structure and spliceosome alterations: a role for CWC22 JOURNAL Dis Model Mech 10 (3), 215-224 (2017) PUBMED 28250049 REMARK GeneRIF: These findings identify subtle but significant alterations in spliceosome structure and function, including dysregulated Cajal bodies and CWC22 overexpression, in diabetic sensory neurons that offer new ideas regarding diabetic sensory neurodegeneration in polyneuropathy. REFERENCE 4 (bases 1 to 1892) AUTHORS Morgan,A.P., Holt,J.M., McMullan,R.C., Bell,T.A., Clayshulte,A.M., Didion,J.P., Yadgary,L., Thybert,D., Odom,D.T., Flicek,P., McMillan,L. and de Villena,F.P. TITLE The Evolutionary Fates of a Large Segmental Duplication in Mouse JOURNAL Genetics 204 (1), 267-285 (2016) PUBMED 27371833 REMARK GeneRIF: Authors have reconstructed the origin and history of a 127-kbp segmental duplication, R2d, in the house mouse (Mus musculus). R2d contains a single protein-coding gene, Cwc22 De novo assembly of both the ancestral (R2d1) and the derived (R2d2) copies reveals that they have been subject to nonallelic gene conversion events spanning tens of kilobases. REFERENCE 5 (bases 1 to 1892) AUTHORS Pezer,Z., Harr,B., Teschke,M., Babiker,H. and Tautz,D. TITLE Divergence patterns of genic copy number variation in natural populations of the house mouse (Mus musculus domesticus) reveal three conserved genes with major population-specific expansions JOURNAL Genome Res 25 (8), 1114-1124 (2015) PUBMED 26149421 REMARK GeneRIF: Study showed major differences in gene copy number in natural populations. CWC22, SFI1, and HJURP are highly conserved genes with the most copy-number variation. They all exhibit population-specific expansion patterns, perhaps for local adaptations. REFERENCE 6 (bases 1 to 1892) AUTHORS Osipovich,A.B., Long,Q., Manduchi,E., Gangula,R., Hipkens,S.B., Schneider,J., Okubo,T., Stoeckert,C.J. Jr., Takada,S. and Magnuson,M.A. TITLE Insm1 promotes endocrine cell differentiation by modulating the expression of a network of genes that includes Neurog3 and Ripply3 JOURNAL Development 141 (15), 2939-2949 (2014) PUBMED 25053427 REFERENCE 7 (bases 1 to 1892) AUTHORS Tamplin,O.J., Kinzel,D., Cox,B.J., Bell,C.E., Rossant,J. and Lickert,H. TITLE Microarray analysis of Foxa2 mutant mouse embryos reveals novel gene expression and inductive roles for the gastrula organizer and its derivatives JOURNAL BMC Genomics 9, 511 (2008) PUBMED 18973680 REMARK Publication Status: Online-Only REFERENCE 8 (bases 1 to 1892) AUTHORS Bulfone,A., Carotenuto,P., Faedo,A., Aglio,V., Garzia,L., Bello,A.M., Basile,A., Andre,A., Cocchia,M., Guardiola,O., Ballabio,A., Rubenstein,J.L. and Zollo,M. TITLE Telencephalic embryonic subtractive sequences: a unique collection of neurodevelopmental genes JOURNAL J Neurosci 25 (33), 7586-7600 (2005) PUBMED 16107646 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AL928791.11 and AL928915.24. ##Evidence-Data-START## Transcript exon combination :: SRR7345562.3553631.1, SRR17784643.178350.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMN00849374, SAMN00849375 [ECO:0006172] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-45 AL928791.11 13473-13517 c 46-175 AL928791.11 3916-4045 c 176-243 AL928915.24 143901-143968 c 244-354 AL928915.24 142637-142747 c 355-597 AL928915.24 140458-140700 c 598-1892 AL928915.24 137244-138538 c FEATURES Location/Qualifiers source 1..1892 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="2" /map="2 46.45 cM" gene 1..1892 /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" /note="CWC22 spliceosome-associated protein" /db_xref="GeneID:80744" /db_xref="MGI:MGI:2136773" exon 1..45 /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" /inference="alignment:Splign:2.1.0" exon 46..175 /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" /inference="alignment:Splign:2.1.0" misc_feature 137..139 /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" /note="upstream in-frame stop codon" CDS 149..730 /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" /note="isoform 11 is encoded by transcript variant 17; pre-mRNA-splicing factor CWC22 homolog; nucampholin homolog; CWC22 spliceosome-associated protein homolog" /codon_start=1 /product="pre-mRNA-splicing factor CWC22 homolog isoform 11" /protein_id="NP_001408874.1" /db_xref="GeneID:80744" /db_xref="MGI:MGI:2136773" /translation="
MKSSVAHMKQSSGHNRRETHSSYRRSSSPEDRYTEQERSPRDRGYSDYSRSDYERSRRGYSYDDSMESRSRDREKRRERERDADHRKRSRKSPSPDRSPARGGGQSSPQEEPTWKKKKDELDPLLTRTGGAYIPPAKLRMMQEQITDKSSLAYQRMSWEALKKSINGLINKVNISNISIIIQELLQENIVRGR"
misc_feature 173..>610 /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" /note="U2 snRNP auxilliary factor, large subunit, splicing factor; Region: U2AF_lg; TIGR01642" /db_xref="CDD:273727" misc_feature 263..265 /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:Q9HCG8; propagated from UniProtKB/Swiss-Prot (Q8C5N3.1); phosphorylation site" misc_feature 329..331 /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:Q9HCG8; propagated from UniProtKB/Swiss-Prot (Q8C5N3.1); phosphorylation site" misc_feature 467..469 /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:17242355, ECO:0007744|PubMed:21183079; propagated from UniProtKB/Swiss-Prot (Q8C5N3.1); phosphorylation site" exon 176..243 /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" /inference="alignment:Splign:2.1.0" exon 244..354 /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" /inference="alignment:Splign:2.1.0" exon 355..597 /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" /inference="alignment:Splign:2.1.0" exon 598..1892 /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" /inference="alignment:Splign:2.1.0" regulatory 908..913 /regulatory_class="polyA_signal_sequence" /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" /note="hexamer: AATAAA" polyA_site 927 /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" regulatory 1873..1878 /regulatory_class="polyA_signal_sequence" /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" /note="hexamer: AATAAA" polyA_site 1892 /gene="Cwc22" /gene_synonym="B230213M24; mKIAA1604" /note="major polyA site" ORIGIN
gaactgacgctcttccggtatgatggcggcgcggtggagctttaggtgacgtgtagagacagaaaaagaaaactgtcgaggaactcaaaccactgagcacgtgtcacttgaatgaacctgaagaatctggggcagctgacagcagaaaatgaaaagtagtgtggcacacatgaagcagtcctctggtcacaacagaagggagacccacagttcataccgccggagctcctccccagaagacagatacacagagcaagagcggtccccccgggatagaggttactctgattacagccggtcagactatgagcgatctagaagaggatactcttacgatgacagcatggaatcacgaagtagggaccgagaaaaacgcagagagagagagagagatgcagatcatcggaaacggtcccggaaatcgccatcccctgacaggagtccagcccgaggcggagggcagagttctcctcaggaggaaccgacatggaagaagaagaaggatgagctggacccgctgctcacccgcactgggggagcgtatatccctcctgcgaagctcaggatgatgcaggagcagatcacagataaaagcagcttagcatatcagaggatgagctgggaggctctgaagaaatccatcaatggtctcatcaacaaggtcaacatctctaatataagcattattatccaagagctccttcaagagaacattgtcagagggaggtaagtagccagaaccttgtatatttcatagtaactcattgaaagaagcataatgtctctgaacagtaagcattgatttgttatgctacttcattttaaaggtttttgtgaatgtttatttgaaatacagttctttttaaatgtaggctgttaaataacttaaaccatgttgttcaagagtaataaaccagtgcttttggagatttgctatcatgccatagttttgcgtggatatttattgaatgtctccaataatttaaatccatgaggcataacaattattaaaatatgctatttcaaaccactttatttttttttaattggcataaaatctttataaattttttagtaacagtgtgctactttaatatgtatattctgtgttgtcatgtgtcaggatttctttaattttttttaatgctgagtggcattccattgtgtaaatgacattccctgtctgtcattgacatggcactcactccctttggctcttgtgggtaatggtgtgggggtgtgcggtgtagctcagaggcttagtcttccctgctggctgcactgctgcgcattcctgttcacagtccctgtgtgcttcctgttctctgcctccttggaaacgctcacctttggttatttttatggcagccattatttaggtatgagacgatacatcgtgtgccttgactctgtattcgtctgataggtgatgcttcatgtcagcatgtctgtatcgtcttgaaatgtctagttagatgttttgtcaggctttgaaactaatgttttattactttggcagatattttggatattagctccttaagagataaacggcttgcagatcctttctcccatctgtatttgtctcttggcttcttgcatggtttctagcactgtccagagccttttagatcagtgcagtgccatttgtcaagttttcttgggttatttagttctgtttagaaatgtgtcaatccaggcagatattgtcaagcttccctcctggaagttgtacagattctgtttgttaatcagtttagattgctttgtgtgtgttgcgtaagattaaagtatgtttttatttctctgcatgttggcatctggctttcctatcactttggaacacattgcctttatgtcaaaatacaattaaataaaaatgtatgaattta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]