GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-01-18 08:04:23, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NM_001360727             562 bp    mRNA    linear   ROD 23-JUN-2025
DEFINITION  Mus musculus interferon induced transmembrane protein 1 (Ifitm1),
            transcript variant 3, mRNA.
ACCESSION   NM_001360727 XM_006536238
VERSION     NM_001360727.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 562)
  AUTHORS   Lv,Y., Zou,W., Li,L., Zhang,S., Liang,J., Pu,J. and Jiao,J.
  TITLE     IFITM2 Modulates Endocytosis Maintaining Neural Stem Cells in
            Developing Neocortex
  JOURNAL   Adv Sci (Weinh) 12 (17), e2501593 (2025)
   PUBMED   40052215
REFERENCE   2  (bases 1 to 562)
  AUTHORS   Adams,D.J., Barlas,B., McIntyre,R.E., Salguero,I., van der
            Weyden,L., Barros,A., Vicente,J.R., Karimpour,N., Haider,A.,
            Ranzani,M., Turner,G., Thompson,N.A., Harle,V., Olvera-Leon,R.,
            Robles-Espinoza,C.D., Speak,A.O., Geisler,N., Weninger,W.J.,
            Geyer,S.H., Hewinson,J., Karp,N.A., Fu,B., Yang,F., Kozik,Z.,
            Choudhary,J., Yu,L., van Ruiten,M.S., Rowland,B.D., Lelliott,C.J.,
            Del Castillo Velasco-Herrera,M., Verstraten,R., Bruckner,L.,
            Henssen,A.G., Rooimans,M.A., de Lange,J., Mohun,T.J., Arends,M.J.,
            Kentistou,K.A., Coelho,P.A., Zhao,Y., Zecchini,H., Perry,J.R.B.,
            Jackson,S.P. and Balmus,G.
  CONSRTM   Sanger Mouse Genetics Project
  TITLE     Genetic determinants of micronucleus formation in vivo
  JOURNAL   Nature 627 (8002), 130-136 (2024)
   PUBMED   38355793
REFERENCE   3  (bases 1 to 562)
  AUTHORS   Zhang,X., Yuan,S., Li,H., Zhan,J., Wang,F., Fan,J., Nie,X.,
            Wang,Y., Wen,Z., Chen,Y., Chen,C. and Wang,D.W.
  TITLE     The double face of miR-320: cardiomyocytes-derived miR-320
            deteriorated while fibroblasts-derived miR-320 protected against
            heart failure induced by transverse aortic constriction
  JOURNAL   Signal Transduct Target Ther 6 (1), 69 (2021)
   PUBMED   33597502
  REMARK    GeneRIF: The double face of miR-320: cardiomyocytes-derived miR-320
            deteriorated while fibroblasts-derived miR-320 protected against
            heart failure induced by transverse aortic constriction.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 562)
  AUTHORS   Chal,J., Al Tanoury,Z., Oginuma,M., Moncuquet,P., Gobert,B.,
            Miyanari,A., Tassy,O., Guevara,G., Hubaud,A., Bera,A., Sumara,O.,
            Garnier,J.M., Kennedy,L., Knockaert,M., Gayraud-Morel,B.,
            Tajbakhsh,S. and Pourquie,O.
  TITLE     Recapitulating early development of mouse musculoskeletal
            precursors of the paraxial mesoderm in vitro
  JOURNAL   Development 145 (6) (2018)
   PUBMED   29555813
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 562)
  AUTHORS   Patoine,A., Husseini,A., Kasaai,B., Gaumond,M.H. and Moffatt,P.
  TITLE     The osteogenic cell surface marker BRIL/IFITM5 is dispensable for
            bone development and homeostasis in mice
  JOURNAL   PLoS One 12 (9), e0184568 (2017)
   PUBMED   28880886
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 562)
  AUTHORS   Yang,G., Xu,Y., Chen,X. and Hu,G.
  TITLE     IFITM1 plays an essential role in the antiproliferative action of
            interferon-gamma
  JOURNAL   Oncogene 26 (4), 594-603 (2007)
   PUBMED   16847454
  REMARK    GeneRIF: The antiproliferative action of IFN-gamma requires the
            induction of IFITM1.
REFERENCE   7  (bases 1 to 562)
  AUTHORS   Tanaka,S.S., Yamaguchi,Y.L., Tsoi,B., Lickert,H. and Tam,P.P.
  TITLE     IFITM/Mil/fragilis family proteins IFITM1 and IFITM3 play distinct
            roles in mouse primordial germ cell homing and repulsion
  JOURNAL   Dev Cell 9 (6), 745-756 (2005)
   PUBMED   16326387
REFERENCE   8  (bases 1 to 562)
  AUTHORS   Lickert,H., Cox,B., Wehrle,C., Taketo,M.M., Kemler,R. and
            Rossant,J.
  TITLE     Dissecting Wnt/beta-catenin signaling during gastrulation using RNA
            interference in mouse embryos
  JOURNAL   Development 132 (11), 2599-2609 (2005)
   PUBMED   15857914
  REMARK    GeneRIF: Fragilis2 regulates epithelialization of the somites and
            paraxial mesoderm formation.
REFERENCE   9  (bases 1 to 562)
  AUTHORS   Lange,U.C., Saitou,M., Western,P.S., Barton,S.C. and Surani,M.A.
  TITLE     The fragilis interferon-inducible gene family of transmembrane
            proteins is associated with germ cell specification in mice
  JOURNAL   BMC Dev Biol 3, 1 (2003)
   PUBMED   12659663
REFERENCE   10 (bases 1 to 562)
  AUTHORS   Tanaka,S.S. and Matsui,Y.
  TITLE     Developmentally regulated expression of mil-1 and mil-2, mouse
            interferon-induced transmembrane protein like genes, during
            formation and differentiation of primordial germ cells
  JOURNAL   Mech Dev 119 Suppl 1, S261-S267 (2002)
   PUBMED   14516695
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC162287.4.
            
            On Feb 10, 2018 this sequence version replaced XM_006536238.1.
            
            Transcript Variant: This variant (3) differs in the 5' UTR compared
            to variant 2. Variants 1, 2, and 3 all encode the same isoform (a).
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BY210477.1, SRR13422601.1773877.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849374, SAMN00849376
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-24                AC162287.4         146353-146376
            25-223              AC162287.4         146565-146763
            224-562             AC162287.4         147814-148152
FEATURES             Location/Qualifiers
     source          1..562
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="7"
                     /map="7 86.2 cM"
     gene            1..562
                     /gene="Ifitm1"
                     /gene_synonym="1110036C17Rik; DSPA2a; Mil-2; Mil2"
                     /note="interferon induced transmembrane protein 1"
                     /db_xref="GeneID:68713"
                     /db_xref="MGI:MGI:1915963"
     exon            1..24
                     /gene="Ifitm1"
                     /gene_synonym="1110036C17Rik; DSPA2a; Mil-2; Mil2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    20..22
                     /gene="Ifitm1"
                     /gene_synonym="1110036C17Rik; DSPA2a; Mil-2; Mil2"
                     /note="upstream in-frame stop codon"
     exon            25..223
                     /gene="Ifitm1"
                     /gene_synonym="1110036C17Rik; DSPA2a; Mil-2; Mil2"
                     /inference="alignment:Splign:2.1.0"
     CDS             41..361
                     /gene="Ifitm1"
                     /gene_synonym="1110036C17Rik; DSPA2a; Mil-2; Mil2"
                     /note="isoform a is encoded by transcript variant 3;
                     interferon induced transmembrane protein 2 like;
                     fragilis2; fragilis protein 2; ifitm-like protein 2;
                     dispanin subfamily A member 2a"
                     /codon_start=1
                     /product="interferon-induced transmembrane protein 1
                     isoform a"
                     /protein_id="NP_001347656.1"
                     /db_xref="CCDS:CCDS21995.1"
                     /db_xref="GeneID:68713"
                     /db_xref="MGI:MGI:1915963"
                     /translation="
MPKEQQEVVVLGSPHISTSATATTINMPEISTPDHVVWSLFNTLFMNFCCLGFVAYAYSVKSRDRKMVGDTTGAQAFASTAKCLNISSLFFTILTAIVVIVVCAIR"
     misc_feature    137..337
                     /gene="Ifitm1"
                     /gene_synonym="1110036C17Rik; DSPA2a; Mil-2; Mil2"
                     /note="Interferon-induced transmembrane protein; Region:
                     CD225; pfam04505"
                     /db_xref="CDD:461336"
     misc_feature    293..355
                     /gene="Ifitm1"
                     /gene_synonym="1110036C17Rik; DSPA2a; Mil-2; Mil2"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9D103.1);
                     transmembrane region"
     exon            224..562
                     /gene="Ifitm1"
                     /gene_synonym="1110036C17Rik; DSPA2a; Mil-2; Mil2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gctctccctgcccacaccctaatgcttcaaaagccgagagatgcctaaggagcagcaagaggtggttgtactggggtcaccccacatctcaacttctgcgacagccaccacaatcaacatgcctgagatctccacgcctgaccatgtggtctggtccctgttcaatacactcttcatgaacttctgctgcctgggcttcgtagcctatgcctactccgtgaagtctagggacaggaagatggtgggtgatacgactggggcccaggccttcgcctccaccgccaagtgcctgaacatcagctccctgttcttcaccatcctcacggccatcgtcgtcatcgttgtctgtgccattagatgatgtgagatgtcttgcaacatctcacagtagataacagattctggggcctcccaggcttgctatgtgtttccttgtctatcgctgccccaaaccctagacttagtcctgaccatttgccccatacatatgcaaatgtgacactcacaaatctgtccatggtggactcaataaagtgcacgtgctgtgactttctgcccctgg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]