ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-07-07 01:02:17, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_001193619 989 bp mRNA linear ROD 20-JUN-2025 DEFINITION Mus musculus claudin 7 (Cldn7), transcript variant 2, mRNA. ACCESSION NM_001193619 VERSION NM_001193619.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 989) AUTHORS Wang,K., Liu,Y., Li,H., Liang,X., Hao,M., Yuan,D. and Ding,L. TITLE Claudin-7 is essential for the maintenance of colonic stem cell homoeostasis via the modulation of Wnt/Notch signalling JOURNAL Cell Death Dis 15 (4), 284 (2024) PUBMED 38654000 REMARK GeneRIF: Claudin-7 is essential for the maintenance of colonic stem cell homoeostasis via the modulation of Wnt/Notch signalling. Publication Status: Online-Only REFERENCE 2 (bases 1 to 989) AUTHORS Ozekin,Y.H., O'Rourke,R. and Bates,E.A. TITLE Single cell sequencing of the mouse anterior palate reveals mesenchymal heterogeneity JOURNAL Dev Dyn 252 (6), 713-727 (2023) PUBMED 36734036 REFERENCE 3 (bases 1 to 989) AUTHORS Lei,Z., Liu,W., Nie,Y., Yang,Y., Chen,G., Huang,L., Wu,H., Lei,Y., Chen,L., Hu,Q., Rong,H., Yu,S., Song,Q., Tong,F. and Guo,J. TITLE EpCAM Is Essential to Maintaining the Immune Homeostasis of Intestines via Keeping the Expression of pIgR in the Intestinal Epithelium of Mice JOURNAL Front Immunol 13, 843378 (2022) PUBMED 35493520 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 989) AUTHORS Nahaboo,W., Eski,S.E., Despin-Guitard,E., Vermeersch,M., Versaevel,M., Saykali,B., Monteyne,D., Gabriele,S., Magin,T.M., Schwarz,N., Leube,R.E., Zwijsen,A., Perez-Morga,D., Singh,S.P. and Migeotte,I. TITLE Keratin filaments mediate the expansion of extra-embryonic membranes in the post-gastrulation mouse embryo JOURNAL EMBO J 41 (7), e108747 (2022) PUBMED 35266581 REFERENCE 5 (bases 1 to 989) AUTHORS Ding,Y., Wang,K., Xu,C., Hao,M., Li,H. and Ding,L. TITLE Intestinal Claudin-7 deficiency impacts the intestinal microbiota in mice with colitis JOURNAL BMC Gastroenterol 22 (1), 24 (2022) PUBMED 35039003 REMARK GeneRIF: Intestinal Claudin-7 deficiency impacts the intestinal microbiota in mice with colitis. Publication Status: Online-Only REFERENCE 6 (bases 1 to 989) AUTHORS Li,W.Y., Huey,C.L. and Yu,A.S. TITLE Expression of claudin-7 and -8 along the mouse nephron JOURNAL Am J Physiol Renal Physiol 286 (6), F1063-F1071 (2004) PUBMED 14722018 REMARK GeneRIF: claudin-7 was found in the same nephron segments as claudin-8, but it was expressed primarily at the basolateral membrane REFERENCE 7 (bases 1 to 989) AUTHORS Turksen,K. and Troy,T.C. TITLE Permeability barrier dysfunction in transgenic mice overexpressing claudin 6 JOURNAL Development 129 (7), 1775-1784 (2002) PUBMED 11923212 REFERENCE 8 (bases 1 to 989) AUTHORS Niimi,T., Nagashima,K., Ward,J.M., Minoo,P., Zimonjic,D.B., Popescu,N.C. and Kimura,S. TITLE claudin-18, a novel downstream target gene for the T/EBP/NKX2.1 homeodomain transcription factor, encodes lung- and stomach-specific isoforms through alternative splicing JOURNAL Mol Cell Biol 21 (21), 7380-7390 (2001) PUBMED 11585919 REFERENCE 9 (bases 1 to 989) AUTHORS Itoh,M., Furuse,M., Morita,K., Kubota,K., Saitou,M. and Tsukita,S. TITLE Direct binding of three tight junction-associated MAGUKs, ZO-1, ZO-2, and ZO-3, with the COOH termini of claudins JOURNAL J Cell Biol 147 (6), 1351-1363 (1999) PUBMED 10601346 REFERENCE 10 (bases 1 to 989) AUTHORS Morita,K., Furuse,M., Fujimoto,K. and Tsukita,S. TITLE Claudin multigene family encoding four-transmembrane domain protein components of tight junction strands JOURNAL Proc Natl Acad Sci U S A 96 (2), 511-516 (1999) PUBMED 9892664 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL596185.12. Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is expressed constitutively in the mammary epithelium throughout development, and might be involved in vesicle trafficking to the basolateral membrane. It is essential for NaCl homeostasis in distal nephrons. The knockout mice lacking this gene showed severe salt wasting, chronic dehydration, and growth retardation, and died within 12 days after birth. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2010]. Transcript Variant: This variant (2) has an alternate 5' UTR, as compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BQ949675.1, BI854023.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849374, SAMN00849377 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-142 AL596185.12 76424-76565 143-407 AL596185.12 77530-77794 408-572 AL596185.12 78588-78752 573-657 AL596185.12 78865-78949 658-989 AL596185.12 79200-79531 FEATURES Location/Qualifiers source 1..989 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="11" /map="11 42.94 cM" gene 1..989 /gene="Cldn7" /note="claudin 7" /db_xref="GeneID:53624" /db_xref="MGI:MGI:1859285" exon 1..142 /gene="Cldn7" /inference="alignment:Splign:2.1.0" exon 143..407 /gene="Cldn7" /inference="alignment:Splign:2.1.0" misc_feature 173..175 /gene="Cldn7" /note="upstream in-frame stop codon" CDS 185..820 /gene="Cldn7" /codon_start=1 /product="claudin-7" /protein_id="NP_001180548.1" /db_xref="CCDS:CCDS24925.1" /db_xref="GeneID:53624" /db_xref="MGI:MGI:1859285" /translation="
MANSGLQLLGFSMAMLGWVGLIASTAIPQWQMSSYAGDNIITAQAMYKGLWMECVTQSTGMMSCKMYDSVLALPGALQATRALMVVSLVLGFLAMFVATMGMKCTRCGGDDKAKKARIAMTGGIVFIVAGLAALVACSWIGHQIVTDFYNPLTPMNVKYEFGPAIFIGWAGSALVLLGGALLSCSCPGSESKAAYRAPRSYPKSNSSKEYV"
misc_feature 194..697
/gene="Cldn7"
/note="PMP-22/EMP/MP20/Claudin family; Region:
PMP22_Claudin; pfam00822"
/db_xref="CDD:395662"
misc_feature 206..268
/gene="Cldn7"
/note="propagated from UniProtKB/Swiss-Prot (Q9Z261.1);
transmembrane region"
misc_feature 428..490
/gene="Cldn7"
/note="propagated from UniProtKB/Swiss-Prot (Q9Z261.1);
transmembrane region"
misc_feature 542..604
/gene="Cldn7"
/note="propagated from UniProtKB/Swiss-Prot (Q9Z261.1);
transmembrane region"
misc_feature 665..727
/gene="Cldn7"
/note="propagated from UniProtKB/Swiss-Prot (Q9Z261.1);
transmembrane region"
misc_feature 812..817
/gene="Cldn7"
/note="propagated from UniProtKB/Swiss-Prot (Q9Z261.1);
Region: Interactions with TJP1, TJP2 and TJP3.
/evidence=ECO:0000250"
exon 408..572
/gene="Cldn7"
/inference="alignment:Splign:2.1.0"
exon 573..657
/gene="Cldn7"
/inference="alignment:Splign:2.1.0"
exon 658..989
/gene="Cldn7"
/inference="alignment:Splign:2.1.0"
regulatory 965..970
/regulatory_class="polyA_signal_sequence"
/gene="Cldn7"
/note="hexamer: AATAAA"
polyA_site 985
/gene="Cldn7"
/note="major polyA site"
ORIGIN
cttcgggtagaaggagcctctatgttggaggagacactgacaggctcaggtgctaagtcctgtacctacctggtcctgggaccaggcctgtgggaggactgtcggagagccgtgtcttgtggagggcttgagcggtgaagcgggtcgccctcccggcgcgtcccgtcttttctgagacaaggaaatggccaactcgggcctgcaactgctgggcttttcaatggccatgcttggctgggtgggcctgatagcgagcactgccatccctcagtggcagatgagctcctatgcgggcgacaacatcatcacagcccaggccatgtacaaggggctctggatggagtgcgtcacgcagagcaccggcatgatgagctgcaaaatgtacgactcggtgctcgccctgccgggagccctgcaggccactcgagccttaatggtggtgtccctggtgttgggcttcttagccatgtttgtcgccacgatgggcatgaagtgcacacgctgtgggggagatgacaaagcgaagaaggcccgaatagctatgactggaggcattgttttcattgtggcaggtcttgctgccttggtagcatgttcctggattggtcatcagattgtcacagacttttataaccccttgacgcccatgaacgttaagtacgagtttggacctgccatctttatcggctgggcagggtctgctctggtccttctgggaggtgccctgctctcttgctcctgtccaggcagtgaaagcaaagctgcgtaccgagcaccccgctcttaccccaagtccaattcctccaaggaatacgtgtgagctggggagcccagcctgcgggcagggtgggaggcaaaggcctcctggccactccacctccaaacatcatgtatagtttgcttggggggagggcagttggggggttactgggagaggaagacatggggtgtgcttttgtacagaaataaaattaagttttggaaattag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]