GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-07-07 01:02:17, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_001193619             989 bp    mRNA    linear   ROD 20-JUN-2025
DEFINITION  Mus musculus claudin 7 (Cldn7), transcript variant 2, mRNA.
ACCESSION   NM_001193619
VERSION     NM_001193619.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 989)
  AUTHORS   Wang,K., Liu,Y., Li,H., Liang,X., Hao,M., Yuan,D. and Ding,L.
  TITLE     Claudin-7 is essential for the maintenance of colonic stem cell
            homoeostasis via the modulation of Wnt/Notch signalling
  JOURNAL   Cell Death Dis 15 (4), 284 (2024)
   PUBMED   38654000
  REMARK    GeneRIF: Claudin-7 is essential for the maintenance of colonic stem
            cell homoeostasis via the modulation of Wnt/Notch signalling.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 989)
  AUTHORS   Ozekin,Y.H., O'Rourke,R. and Bates,E.A.
  TITLE     Single cell sequencing of the mouse anterior palate reveals
            mesenchymal heterogeneity
  JOURNAL   Dev Dyn 252 (6), 713-727 (2023)
   PUBMED   36734036
REFERENCE   3  (bases 1 to 989)
  AUTHORS   Lei,Z., Liu,W., Nie,Y., Yang,Y., Chen,G., Huang,L., Wu,H., Lei,Y.,
            Chen,L., Hu,Q., Rong,H., Yu,S., Song,Q., Tong,F. and Guo,J.
  TITLE     EpCAM Is Essential to Maintaining the Immune Homeostasis of
            Intestines via Keeping the Expression of pIgR in the Intestinal
            Epithelium of Mice
  JOURNAL   Front Immunol 13, 843378 (2022)
   PUBMED   35493520
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 989)
  AUTHORS   Nahaboo,W., Eski,S.E., Despin-Guitard,E., Vermeersch,M.,
            Versaevel,M., Saykali,B., Monteyne,D., Gabriele,S., Magin,T.M.,
            Schwarz,N., Leube,R.E., Zwijsen,A., Perez-Morga,D., Singh,S.P. and
            Migeotte,I.
  TITLE     Keratin filaments mediate the expansion of extra-embryonic
            membranes in the post-gastrulation mouse embryo
  JOURNAL   EMBO J 41 (7), e108747 (2022)
   PUBMED   35266581
REFERENCE   5  (bases 1 to 989)
  AUTHORS   Ding,Y., Wang,K., Xu,C., Hao,M., Li,H. and Ding,L.
  TITLE     Intestinal Claudin-7 deficiency impacts the intestinal microbiota
            in mice with colitis
  JOURNAL   BMC Gastroenterol 22 (1), 24 (2022)
   PUBMED   35039003
  REMARK    GeneRIF: Intestinal Claudin-7 deficiency impacts the intestinal
            microbiota in mice with colitis.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 989)
  AUTHORS   Li,W.Y., Huey,C.L. and Yu,A.S.
  TITLE     Expression of claudin-7 and -8 along the mouse nephron
  JOURNAL   Am J Physiol Renal Physiol 286 (6), F1063-F1071 (2004)
   PUBMED   14722018
  REMARK    GeneRIF: claudin-7 was found in the same nephron segments as
            claudin-8, but it was expressed primarily at the basolateral
            membrane
REFERENCE   7  (bases 1 to 989)
  AUTHORS   Turksen,K. and Troy,T.C.
  TITLE     Permeability barrier dysfunction in transgenic mice overexpressing
            claudin 6
  JOURNAL   Development 129 (7), 1775-1784 (2002)
   PUBMED   11923212
REFERENCE   8  (bases 1 to 989)
  AUTHORS   Niimi,T., Nagashima,K., Ward,J.M., Minoo,P., Zimonjic,D.B.,
            Popescu,N.C. and Kimura,S.
  TITLE     claudin-18, a novel downstream target gene for the T/EBP/NKX2.1
            homeodomain transcription factor, encodes lung- and
            stomach-specific isoforms through alternative splicing
  JOURNAL   Mol Cell Biol 21 (21), 7380-7390 (2001)
   PUBMED   11585919
REFERENCE   9  (bases 1 to 989)
  AUTHORS   Itoh,M., Furuse,M., Morita,K., Kubota,K., Saitou,M. and Tsukita,S.
  TITLE     Direct binding of three tight junction-associated MAGUKs, ZO-1,
            ZO-2, and ZO-3, with the COOH termini of claudins
  JOURNAL   J Cell Biol 147 (6), 1351-1363 (1999)
   PUBMED   10601346
REFERENCE   10 (bases 1 to 989)
  AUTHORS   Morita,K., Furuse,M., Fujimoto,K. and Tsukita,S.
  TITLE     Claudin multigene family encoding four-transmembrane domain protein
            components of tight junction strands
  JOURNAL   Proc Natl Acad Sci U S A 96 (2), 511-516 (1999)
   PUBMED   9892664
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AL596185.12.
            
            Summary: This gene encodes a member of the claudin family. Claudins
            are integral membrane proteins and components of tight junction
            strands. Tight junction strands serve as a physical barrier to
            prevent solutes and water from passing freely through the
            paracellular space between epithelial or endothelial cell sheets,
            and also play critical roles in maintaining cell polarity and
            signal transductions. This gene is expressed constitutively in the
            mammary epithelium throughout development, and might be involved in
            vesicle trafficking to the basolateral membrane. It is essential
            for NaCl homeostasis in distal nephrons. The knockout mice lacking
            this gene showed severe salt wasting, chronic dehydration, and
            growth retardation, and died within 12 days after birth.
            Alternatively spliced transcript variants have been found for this
            gene. [provided by RefSeq, Aug 2010].
            
            Transcript Variant: This variant (2) has an alternate 5' UTR, as
            compared to variant 1. Variants 1 and 2 encode the same protein.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BQ949675.1, BI854023.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849374, SAMN00849377
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-142               AL596185.12        76424-76565
            143-407             AL596185.12        77530-77794
            408-572             AL596185.12        78588-78752
            573-657             AL596185.12        78865-78949
            658-989             AL596185.12        79200-79531
FEATURES             Location/Qualifiers
     source          1..989
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="11"
                     /map="11 42.94 cM"
     gene            1..989
                     /gene="Cldn7"
                     /note="claudin 7"
                     /db_xref="GeneID:53624"
                     /db_xref="MGI:MGI:1859285"
     exon            1..142
                     /gene="Cldn7"
                     /inference="alignment:Splign:2.1.0"
     exon            143..407
                     /gene="Cldn7"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    173..175
                     /gene="Cldn7"
                     /note="upstream in-frame stop codon"
     CDS             185..820
                     /gene="Cldn7"
                     /codon_start=1
                     /product="claudin-7"
                     /protein_id="NP_001180548.1"
                     /db_xref="CCDS:CCDS24925.1"
                     /db_xref="GeneID:53624"
                     /db_xref="MGI:MGI:1859285"
                     /translation="
MANSGLQLLGFSMAMLGWVGLIASTAIPQWQMSSYAGDNIITAQAMYKGLWMECVTQSTGMMSCKMYDSVLALPGALQATRALMVVSLVLGFLAMFVATMGMKCTRCGGDDKAKKARIAMTGGIVFIVAGLAALVACSWIGHQIVTDFYNPLTPMNVKYEFGPAIFIGWAGSALVLLGGALLSCSCPGSESKAAYRAPRSYPKSNSSKEYV"
     misc_feature    194..697
                     /gene="Cldn7"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; pfam00822"
                     /db_xref="CDD:395662"
     misc_feature    206..268
                     /gene="Cldn7"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z261.1);
                     transmembrane region"
     misc_feature    428..490
                     /gene="Cldn7"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z261.1);
                     transmembrane region"
     misc_feature    542..604
                     /gene="Cldn7"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z261.1);
                     transmembrane region"
     misc_feature    665..727
                     /gene="Cldn7"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z261.1);
                     transmembrane region"
     misc_feature    812..817
                     /gene="Cldn7"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z261.1);
                     Region: Interactions with TJP1, TJP2 and TJP3.
                     /evidence=ECO:0000250"
     exon            408..572
                     /gene="Cldn7"
                     /inference="alignment:Splign:2.1.0"
     exon            573..657
                     /gene="Cldn7"
                     /inference="alignment:Splign:2.1.0"
     exon            658..989
                     /gene="Cldn7"
                     /inference="alignment:Splign:2.1.0"
     regulatory      965..970
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Cldn7"
                     /note="hexamer: AATAAA"
     polyA_site      985
                     /gene="Cldn7"
                     /note="major polyA site"
ORIGIN      
cttcgggtagaaggagcctctatgttggaggagacactgacaggctcaggtgctaagtcctgtacctacctggtcctgggaccaggcctgtgggaggactgtcggagagccgtgtcttgtggagggcttgagcggtgaagcgggtcgccctcccggcgcgtcccgtcttttctgagacaaggaaatggccaactcgggcctgcaactgctgggcttttcaatggccatgcttggctgggtgggcctgatagcgagcactgccatccctcagtggcagatgagctcctatgcgggcgacaacatcatcacagcccaggccatgtacaaggggctctggatggagtgcgtcacgcagagcaccggcatgatgagctgcaaaatgtacgactcggtgctcgccctgccgggagccctgcaggccactcgagccttaatggtggtgtccctggtgttgggcttcttagccatgtttgtcgccacgatgggcatgaagtgcacacgctgtgggggagatgacaaagcgaagaaggcccgaatagctatgactggaggcattgttttcattgtggcaggtcttgctgccttggtagcatgttcctggattggtcatcagattgtcacagacttttataaccccttgacgcccatgaacgttaagtacgagtttggacctgccatctttatcggctgggcagggtctgctctggtccttctgggaggtgccctgctctcttgctcctgtccaggcagtgaaagcaaagctgcgtaccgagcaccccgctcttaccccaagtccaattcctccaaggaatacgtgtgagctggggagcccagcctgcgggcagggtgggaggcaaaggcctcctggccactccacctccaaacatcatgtatagtttgcttggggggagggcagttggggggttactgggagaggaagacatggggtgtgcttttgtacagaaataaaattaagttttggaaattag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]