2025-10-17 07:50:32, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_001167743 3083 bp mRNA linear ROD 27-APR-2025 DEFINITION Mus musculus schlafen 8 (Slfn8), transcript variant 2, mRNA. ACCESSION NM_001167743 VERSION NM_001167743.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 3083) AUTHORS Alvi,E., Mochizuki,A.L., Katsuki,Y., Ogawa,M., Qi,F., Okamoto,Y., Takata,M. and Mu,A. TITLE Mouse Slfn8 and Slfn9 genes complement human cells lacking SLFN11 during the replication stress response JOURNAL Commun Biol 6 (1), 1038 (2023) PUBMED 37833372 REMARK GeneRIF: Mouse Slfn8 and Slfn9 genes complement human cells lacking SLFN11 during the replication stress response. Publication Status: Online-Only REFERENCE 2 (bases 1 to 3083) AUTHORS Yang,J.Y., Deng,X.Y., Li,Y.S., Ma,X.C., Feng,J.X., Yu,B., Chen,Y., Luo,Y.L., Wang,X., Chen,M.L., Fang,Z.X., Zheng,F.X., Li,Y.P., Zhong,Q., Kang,T.B., Song,L.B., Xu,R.H., Zeng,M.S., Chen,W., Zhang,H., Xie,W. and Gao,S. TITLE Structure of Schlafen13 reveals a new class of tRNA/rRNA- targeting RNase engaged in translational control JOURNAL Nat Commun 9 (1), 1165 (2018) PUBMED 29563550 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 3083) AUTHORS Nakagawa,K., Matsuki,T., Zhao,L., Kuniyoshi,K., Tanaka,H., Ebina,I., Yoshida,K.J., Nabeshima,H., Fukushima,K., Kanemaru,H., Yamane,F., Kawasaki,T., Machida,T., Naito,H., Takakura,N., Satoh,T. and Akira,S. TITLE Schlafen-8 is essential for lymphatic endothelial cell activation in experimental autoimmune encephalomyelitis JOURNAL Int Immunol 30 (2), 69-78 (2018) PUBMED 29528433 REMARK GeneRIF: We demonstrated that Slfn8-/- mice were resistant to the development of EAE. REFERENCE 4 (bases 1 to 3083) AUTHORS Mavrommatis,E., Arslan,A.D., Sassano,A., Hua,Y., Kroczynska,B. and Platanias,L.C. TITLE Expression and regulatory effects of murine Schlafen (Slfn) genes in malignant melanoma and renal cell carcinoma JOURNAL J Biol Chem 288 (46), 33006-33015 (2013) PUBMED 24089532 REMARK GeneRIF: several mouse Slfn genes are up-regulated in response to IFN treatment of mouse melanoma and renal cell carcinoma cells, including Slfn1, Slfn2, Slfn4, Slfn5, and Slfn8. REFERENCE 5 (bases 1 to 3083) AUTHORS Bustos,O., Naik,S., Ayers,G., Casola,C., Perez-Lamigueiro,M.A., Chippindale,P.T., Pritham,E.J. and de la Casa-Esperon,E. TITLE Evolution of the Schlafen genes, a gene family associated with embryonic lethality, meiotic drive, immune processes and orthopoxvirus virulence JOURNAL Gene 447 (1), 1-11 (2009) PUBMED 19619625 REFERENCE 6 (bases 1 to 3083) AUTHORS Neumann,B., Zhao,L., Murphy,K. and Gonda,T.J. TITLE Subcellular localization of the Schlafen protein family JOURNAL Biochem Biophys Res Commun 370 (1), 62-66 (2008) PUBMED 18355440 REFERENCE 7 (bases 1 to 3083) AUTHORS Geserick,P., Kaiser,F., Klemm,U., Kaufmann,S.H. and Zerrahn,J. TITLE Modulation of T cell development and activation by novel members of the Schlafen (slfn) gene family harbouring an RNA helicase-like motif JOURNAL Int Immunol 16 (10), 1535-1548 (2004) PUBMED 15351786 REMARK GeneRIF: functional participation of slfn8 in the regulatory networks governing T cell development and growth appears to be cell type specific COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from BC152549.1 and AL603745.16. Transcript Variant: This variant (2) lacks one exon in the 5' UTR and one exon in the CDS, as compared to variant 1. The resulting isoform (2) is shorter and has a different C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##Evidence-Data-START## Transcript exon combination :: BC152549.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMN00849375, SAMN00849382 [ECO:0006172] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-2569 BC152549.1 1-2569 2570-3083 AL603745.16 118336-118849 c FEATURES Location/Qualifiers source 1..3083 /organism="Mus musculus" /mol_type="mRNA" /db_xref="taxon:10090" /chromosome="11" /map="11 50.3 cM" gene 1..3083 /gene="Slfn8" /gene_synonym="mSLFN8" /note="schlafen 8" /db_xref="GeneID:276950" /db_xref="MGI:MGI:2672859" exon 1..146 /gene="Slfn8" /gene_synonym="mSLFN8" /inference="alignment:Splign:2.1.0" exon 147..1216 /gene="Slfn8" /gene_synonym="mSLFN8" /inference="alignment:Splign:2.1.0" CDS 154..1377 /gene="Slfn8" /gene_synonym="mSLFN8" /note="isoform 2 is encoded by transcript variant 2; Schlafen family member 8" /codon_start=1 /product="schlafen family member 8 isoform 2" /protein_id="NP_001161215.1" /db_xref="CCDS:CCDS48869.1" /db_xref="GeneID:276950" /db_xref="MGI:MGI:2672859" /translation="
METHPSLAVKWSCPDLTIYAGEVTIGEEDRNKMDSKKRKLEKTRITEAACALLNSGGGLIAMQMTNKSEHPVEMGQDLEKSLRELIMSPNMQAFFETKQQEDQFYIFVKSWSCRPEDGSTKPRICSLGSSLYCRSITSKVAMDSREAFEFLKDKKACIKYRPTDDGAPPAKIPRAMCQNSLESNPAFEIFQSKKLEYGQCLLFSESTSIEFKQFSTKHVQAYMKNIIPEYISAFANTQGGYLFIGVDDKRIILGCPKDNVDRDSLKTVANETISKVPVFHFCSSKDKDKVSYETRVIDVFQEGNLYGYLCVIKVEPFCCAVFSEAPISWMVDKEKGVYRLNTEEWVRMMVDFGPEASSKDLSKDFECQLSLCNSPPHCRPVYSKKGLQHKVDLQQRLFQGQKESARQ"
misc_feature 154..1215 /gene="Slfn8" /gene_synonym="mSLFN8" /note="propagated from UniProtKB/Swiss-Prot (B1ARD8.1); Region: N'-domain region. /evidence=ECO:0000250|UniProtKB:Q5U311" misc_feature <286..1191 /gene="Slfn8" /gene_synonym="mSLFN8" /note="hypothetical protein; Provisional; Region: PHA02782" /db_xref="CDD:165147" exon 1217..1351 /gene="Slfn8" /gene_synonym="mSLFN8" /inference="alignment:Splign:2.1.0" exon 1352..3083 /gene="Slfn8" /gene_synonym="mSLFN8" /inference="alignment:Splign:2.1.0" ORIGIN
ggaacactacccggccacagaccagaaggatcttgtcaggaggctggcttctggaaagaaagggagacttacattcctgtctgtttccaaattctgctttccaaggtggccagggaacagggatcaagagaactccactggaagtggatcagcatggagacacatccctccttagcagtgaaatggtcgtgcccagacttgaccatctacgcaggagaagtgactatcggagaagaagatagaaataaaatggactcaaagaaaagaaagctggagaagacaagaattacagaggctgcttgtgctctgttaaactctggaggaggattaattgctatgcaaatgactaacaagagtgagcatcctgtggagatgggacaggacttggaaaagtctttgagagagcttattatgtcccctaatatgcaggctttctttgagaccaagcaacaagaggaccagttctacatttttgttaaatcttggagctgcaggcctgaagatggttctactaagcctcgaatttgcagcctgggctcttctctgtactgtagatctataacttctaaggttgccatggattcaagagaagcatttgaatttctgaaagataagaaggcatgtatcaaatacaggcctactgatgacggagctccaccggctaaaattccgagagccatgtgtcagaacagccttgaatcaaatccagcttttgaaattttccaaagtaagaaacttgaatatggccaatgcttgcttttctctgaatccacatctatagagtttaaacaattctctaccaaacacgtccaagcatatatgaaaaacataattccagaatacatctccgcatttgcaaacacccagggaggctatcttttcattggagtggatgataagagaatcatcttgggatgcccaaaagacaacgttgaccgtgactctttgaaaactgtggcgaatgaaacaatatccaaggtgccagttttccatttttgttcatctaaagacaaggacaaggtgtcttatgagaccagagtcatagatgtgtttcaagagggaaatttgtatggttatctctgtgtgatcaaagtagagccgttctgctgtgcagtgttctcagaggctcccatttcatggatggtagacaaggagaaaggtgtctacagactgaacactgaggaatgggtacgcatgatggtggattttggcccagaggcatcttccaaagatctatctaaagattttgaatgtcagctgagtctatgcaacagccccccacactgcagaccagtgtattctaaaaaaggactgcagcataaagttgacctgcagcagcgtttatttcaagggcaaaaagaatctgccaggcagtgacccggaaaaccttcatgaattatagatttaagacaaacagtttccaacacatcattgttgatgaagcccagaatttccgcactgaggatggaaactggtatgggaaggcaaaagcaatctctcgaagagtgaaaagttgtcctggaatgttctggatatttctagactattttcagaccagtcatttgaaggagagtggcctcccagatttctcacgccagtatccaagggaagagctcacacaagtagtacgcaatggagataaaatagctgagttcctacaaaaagagttgcaaaaaatcagagataaccctccatgcagcatcccccgacagtccctaaacattgtccatgaatttaagtggtcccaaagtgtatcaggcaacattaaaactgaacaattcactttggaagacatggtaatctatgtagcagataagtgttatgatttcttgcgtaaaggctattctctccaagatattgcagtgcttttcagcacagataaggagaagaaaacctatgagtctatgttcctcggagaaatgaggaagaggaggagagcatctgagatgaatcacgcgtatctctgtgattctaacatgtttgacagcatccgtcgattctcaggactggaaagaagcattgtgtttggtatcaatcccattgcaactgagcagcccatttcccacaacctattgctctgcctggcttccagagcaatgaaacatctatatatcctgtatttttcaactcctgaggggcatagctcaacggaggcatgctgaatgggatgtatgaggacctaggttcaatccctgatgatgagaaagttaaatcaagtcgaggtccttcaggacaagaagaaagataaagatataacaaaaccttgtgctgtagttttgacacatgtaggaaaaaaattaccaatgtgtatatcgtaactaactgaggctgaaaacaaagctggagagaaggctggcaaggcaatgtacacatgacataggctatgggaacgttgagaccataaggactgaaaccagagatgaagacaactcaatacagtaagtcatatccaaatcttaaaacagacttccattttaaattgttgaaaacatttatgaaaatattgtatacagttaaagaaaaagactaaaaacacaatattaagtagtactggggtctgtgcctggagctgatcctgtgccacagtgctcaatacccaaacaccgctgggaaagaactggcctcccacaagtgtggacaagcctgtgagcgcaggtaagtccaccactcctgctcagaggtacgcacctggaaccctccggacacaggaaccagatgatgagaggcaacagcaagaacataaacaacagacaccaaggccacttggcatcatcagaacccggttctcccaccacagtgagccatcgataccacaacacaccagaaaaacaagactctgatttaaaatcacatctcatgatgatgatagagaactttaagaaggacataaataattcccttaaagaaatacagggacaggagggatggcttagtggttataagcactgacttaggtcctgagttcaattcccagaaaagacatcgtggctcacaaccatctctaatggggatctaatactctcttctagtgtgtctgaaggctgggaccgtgtactcacatacatgaaataaataaaataagg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]