GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-06-29 20:54:56, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       NM_001167743            3083 bp    mRNA    linear   ROD 05-FEB-2024
DEFINITION  Mus musculus schlafen 8 (Slfn8), transcript variant 2, mRNA.
ACCESSION   NM_001167743
VERSION     NM_001167743.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 3083)
  AUTHORS   Alvi,E., Mochizuki,A.L., Katsuki,Y., Ogawa,M., Qi,F., Okamoto,Y.,
            Takata,M. and Mu,A.
  TITLE     Mouse Slfn8 and Slfn9 genes complement human cells lacking SLFN11
            during the replication stress response
  JOURNAL   Commun Biol 6 (1), 1038 (2023)
   PUBMED   37833372
  REMARK    GeneRIF: Mouse Slfn8 and Slfn9 genes complement human cells lacking
            SLFN11 during the replication stress response.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 3083)
  AUTHORS   Yang,J.Y., Deng,X.Y., Li,Y.S., Ma,X.C., Feng,J.X., Yu,B., Chen,Y.,
            Luo,Y.L., Wang,X., Chen,M.L., Fang,Z.X., Zheng,F.X., Li,Y.P.,
            Zhong,Q., Kang,T.B., Song,L.B., Xu,R.H., Zeng,M.S., Chen,W.,
            Zhang,H., Xie,W. and Gao,S.
  TITLE     Structure of Schlafen13 reveals a new class of tRNA/rRNA- targeting
            RNase engaged in translational control
  JOURNAL   Nat Commun 9 (1), 1165 (2018)
   PUBMED   29563550
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 3083)
  AUTHORS   Nakagawa,K., Matsuki,T., Zhao,L., Kuniyoshi,K., Tanaka,H.,
            Ebina,I., Yoshida,K.J., Nabeshima,H., Fukushima,K., Kanemaru,H.,
            Yamane,F., Kawasaki,T., Machida,T., Naito,H., Takakura,N., Satoh,T.
            and Akira,S.
  TITLE     Schlafen-8 is essential for lymphatic endothelial cell activation
            in experimental autoimmune encephalomyelitis
  JOURNAL   Int Immunol 30 (2), 69-78 (2018)
   PUBMED   29528433
  REMARK    GeneRIF: We demonstrated that Slfn8-/- mice were resistant to the
            development of EAE.
REFERENCE   4  (bases 1 to 3083)
  AUTHORS   Mavrommatis,E., Arslan,A.D., Sassano,A., Hua,Y., Kroczynska,B. and
            Platanias,L.C.
  TITLE     Expression and regulatory effects of murine Schlafen (Slfn) genes
            in malignant melanoma and renal cell carcinoma
  JOURNAL   J Biol Chem 288 (46), 33006-33015 (2013)
   PUBMED   24089532
  REMARK    GeneRIF: several mouse Slfn genes are up-regulated in response to
            IFN treatment of mouse melanoma and renal cell carcinoma cells,
            including Slfn1, Slfn2, Slfn4, Slfn5, and Slfn8.
REFERENCE   5  (bases 1 to 3083)
  AUTHORS   Bustos,O., Naik,S., Ayers,G., Casola,C., Perez-Lamigueiro,M.A.,
            Chippindale,P.T., Pritham,E.J. and de la Casa-Esperon,E.
  TITLE     Evolution of the Schlafen genes, a gene family associated with
            embryonic lethality, meiotic drive, immune processes and
            orthopoxvirus virulence
  JOURNAL   Gene 447 (1), 1-11 (2009)
   PUBMED   19619625
REFERENCE   6  (bases 1 to 3083)
  AUTHORS   Neumann,B., Zhao,L., Murphy,K. and Gonda,T.J.
  TITLE     Subcellular localization of the Schlafen protein family
  JOURNAL   Biochem Biophys Res Commun 370 (1), 62-66 (2008)
   PUBMED   18355440
REFERENCE   7  (bases 1 to 3083)
  AUTHORS   Geserick,P., Kaiser,F., Klemm,U., Kaufmann,S.H. and Zerrahn,J.
  TITLE     Modulation of T cell development and activation by novel members of
            the Schlafen (slfn) gene family harbouring an RNA helicase-like
            motif
  JOURNAL   Int Immunol 16 (10), 1535-1548 (2004)
   PUBMED   15351786
  REMARK    GeneRIF: functional participation of slfn8 in the regulatory
            networks governing T cell development and growth appears to be cell
            type specific
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BC152549.1 and AL603745.16.
            
            Transcript Variant: This variant (2) lacks one exon in the 5' UTR
            and one exon in the CDS, as compared to variant 1. The resulting
            isoform (2) is shorter and has a different C-terminus, as compared
            to isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC152549.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMN00849375,
                                           SAMN00849382 [ECO:0006172]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-2569              BC152549.1         1-2569
            2570-3083           AL603745.16        118336-118849       c
FEATURES             Location/Qualifiers
     source          1..3083
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10090"
                     /chromosome="11"
                     /map="11 50.3 cM"
     gene            1..3083
                     /gene="Slfn8"
                     /gene_synonym="mSLFN8"
                     /note="schlafen 8"
                     /db_xref="GeneID:276950"
                     /db_xref="MGI:MGI:2672859"
     exon            1..146
                     /gene="Slfn8"
                     /gene_synonym="mSLFN8"
                     /inference="alignment:Splign:2.1.0"
     exon            147..1216
                     /gene="Slfn8"
                     /gene_synonym="mSLFN8"
                     /inference="alignment:Splign:2.1.0"
     CDS             154..1377
                     /gene="Slfn8"
                     /gene_synonym="mSLFN8"
                     /note="isoform 2 is encoded by transcript variant 2;
                     Schlafen family member 8"
                     /codon_start=1
                     /product="schlafen family member 8 isoform 2"
                     /protein_id="NP_001161215.1"
                     /db_xref="CCDS:CCDS48869.1"
                     /db_xref="GeneID:276950"
                     /db_xref="MGI:MGI:2672859"
                     /translation="
METHPSLAVKWSCPDLTIYAGEVTIGEEDRNKMDSKKRKLEKTRITEAACALLNSGGGLIAMQMTNKSEHPVEMGQDLEKSLRELIMSPNMQAFFETKQQEDQFYIFVKSWSCRPEDGSTKPRICSLGSSLYCRSITSKVAMDSREAFEFLKDKKACIKYRPTDDGAPPAKIPRAMCQNSLESNPAFEIFQSKKLEYGQCLLFSESTSIEFKQFSTKHVQAYMKNIIPEYISAFANTQGGYLFIGVDDKRIILGCPKDNVDRDSLKTVANETISKVPVFHFCSSKDKDKVSYETRVIDVFQEGNLYGYLCVIKVEPFCCAVFSEAPISWMVDKEKGVYRLNTEEWVRMMVDFGPEASSKDLSKDFECQLSLCNSPPHCRPVYSKKGLQHKVDLQQRLFQGQKESARQ"
     misc_feature    154..1215
                     /gene="Slfn8"
                     /gene_synonym="mSLFN8"
                     /note="propagated from UniProtKB/Swiss-Prot (B1ARD8.1);
                     Region: N'-domain region.
                     /evidence=ECO:0000250|UniProtKB:Q5U311"
     misc_feature    <286..1191
                     /gene="Slfn8"
                     /gene_synonym="mSLFN8"
                     /note="hypothetical protein; Provisional; Region:
                     PHA02782"
                     /db_xref="CDD:165147"
     exon            1217..1351
                     /gene="Slfn8"
                     /gene_synonym="mSLFN8"
                     /inference="alignment:Splign:2.1.0"
     exon            1352..3083
                     /gene="Slfn8"
                     /gene_synonym="mSLFN8"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ggaacactacccggccacagaccagaaggatcttgtcaggaggctggcttctggaaagaaagggagacttacattcctgtctgtttccaaattctgctttccaaggtggccagggaacagggatcaagagaactccactggaagtggatcagcatggagacacatccctccttagcagtgaaatggtcgtgcccagacttgaccatctacgcaggagaagtgactatcggagaagaagatagaaataaaatggactcaaagaaaagaaagctggagaagacaagaattacagaggctgcttgtgctctgttaaactctggaggaggattaattgctatgcaaatgactaacaagagtgagcatcctgtggagatgggacaggacttggaaaagtctttgagagagcttattatgtcccctaatatgcaggctttctttgagaccaagcaacaagaggaccagttctacatttttgttaaatcttggagctgcaggcctgaagatggttctactaagcctcgaatttgcagcctgggctcttctctgtactgtagatctataacttctaaggttgccatggattcaagagaagcatttgaatttctgaaagataagaaggcatgtatcaaatacaggcctactgatgacggagctccaccggctaaaattccgagagccatgtgtcagaacagccttgaatcaaatccagcttttgaaattttccaaagtaagaaacttgaatatggccaatgcttgcttttctctgaatccacatctatagagtttaaacaattctctaccaaacacgtccaagcatatatgaaaaacataattccagaatacatctccgcatttgcaaacacccagggaggctatcttttcattggagtggatgataagagaatcatcttgggatgcccaaaagacaacgttgaccgtgactctttgaaaactgtggcgaatgaaacaatatccaaggtgccagttttccatttttgttcatctaaagacaaggacaaggtgtcttatgagaccagagtcatagatgtgtttcaagagggaaatttgtatggttatctctgtgtgatcaaagtagagccgttctgctgtgcagtgttctcagaggctcccatttcatggatggtagacaaggagaaaggtgtctacagactgaacactgaggaatgggtacgcatgatggtggattttggcccagaggcatcttccaaagatctatctaaagattttgaatgtcagctgagtctatgcaacagccccccacactgcagaccagtgtattctaaaaaaggactgcagcataaagttgacctgcagcagcgtttatttcaagggcaaaaagaatctgccaggcagtgacccggaaaaccttcatgaattatagatttaagacaaacagtttccaacacatcattgttgatgaagcccagaatttccgcactgaggatggaaactggtatgggaaggcaaaagcaatctctcgaagagtgaaaagttgtcctggaatgttctggatatttctagactattttcagaccagtcatttgaaggagagtggcctcccagatttctcacgccagtatccaagggaagagctcacacaagtagtacgcaatggagataaaatagctgagttcctacaaaaagagttgcaaaaaatcagagataaccctccatgcagcatcccccgacagtccctaaacattgtccatgaatttaagtggtcccaaagtgtatcaggcaacattaaaactgaacaattcactttggaagacatggtaatctatgtagcagataagtgttatgatttcttgcgtaaaggctattctctccaagatattgcagtgcttttcagcacagataaggagaagaaaacctatgagtctatgttcctcggagaaatgaggaagaggaggagagcatctgagatgaatcacgcgtatctctgtgattctaacatgtttgacagcatccgtcgattctcaggactggaaagaagcattgtgtttggtatcaatcccattgcaactgagcagcccatttcccacaacctattgctctgcctggcttccagagcaatgaaacatctatatatcctgtatttttcaactcctgaggggcatagctcaacggaggcatgctgaatgggatgtatgaggacctaggttcaatccctgatgatgagaaagttaaatcaagtcgaggtccttcaggacaagaagaaagataaagatataacaaaaccttgtgctgtagttttgacacatgtaggaaaaaaattaccaatgtgtatatcgtaactaactgaggctgaaaacaaagctggagagaaggctggcaaggcaatgtacacatgacataggctatgggaacgttgagaccataaggactgaaaccagagatgaagacaactcaatacagtaagtcatatccaaatcttaaaacagacttccattttaaattgttgaaaacatttatgaaaatattgtatacagttaaagaaaaagactaaaaacacaatattaagtagtactggggtctgtgcctggagctgatcctgtgccacagtgctcaatacccaaacaccgctgggaaagaactggcctcccacaagtgtggacaagcctgtgagcgcaggtaagtccaccactcctgctcagaggtacgcacctggaaccctccggacacaggaaccagatgatgagaggcaacagcaagaacataaacaacagacaccaaggccacttggcatcatcagaacccggttctcccaccacagtgagccatcgataccacaacacaccagaaaaacaagactctgatttaaaatcacatctcatgatgatgatagagaactttaagaaggacataaataattcccttaaagaaatacagggacaggagggatggcttagtggttataagcactgacttaggtcctgagttcaattcccagaaaagacatcgtggctcacaaccatctctaatggggatctaatactctcttctagtgtgtctgaaggctgggaccgtgtactcacatacatgaaataaataaaataagg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]