ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-01-18 08:04:22, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_001112715 702 bp mRNA linear ROD 23-JUN-2025
DEFINITION Mus musculus interferon induced transmembrane protein 1 (Ifitm1),
transcript variant 2, mRNA.
ACCESSION NM_001112715
VERSION NM_001112715.1
KEYWORDS RefSeq; RefSeq Select.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE 1 (bases 1 to 702)
AUTHORS Lv,Y., Zou,W., Li,L., Zhang,S., Liang,J., Pu,J. and Jiao,J.
TITLE IFITM2 Modulates Endocytosis Maintaining Neural Stem Cells in
Developing Neocortex
JOURNAL Adv Sci (Weinh) 12 (17), e2501593 (2025)
PUBMED 40052215
REFERENCE 2 (bases 1 to 702)
AUTHORS Adams,D.J., Barlas,B., McIntyre,R.E., Salguero,I., van der
Weyden,L., Barros,A., Vicente,J.R., Karimpour,N., Haider,A.,
Ranzani,M., Turner,G., Thompson,N.A., Harle,V., Olvera-Leon,R.,
Robles-Espinoza,C.D., Speak,A.O., Geisler,N., Weninger,W.J.,
Geyer,S.H., Hewinson,J., Karp,N.A., Fu,B., Yang,F., Kozik,Z.,
Choudhary,J., Yu,L., van Ruiten,M.S., Rowland,B.D., Lelliott,C.J.,
Del Castillo Velasco-Herrera,M., Verstraten,R., Bruckner,L.,
Henssen,A.G., Rooimans,M.A., de Lange,J., Mohun,T.J., Arends,M.J.,
Kentistou,K.A., Coelho,P.A., Zhao,Y., Zecchini,H., Perry,J.R.B.,
Jackson,S.P. and Balmus,G.
CONSRTM Sanger Mouse Genetics Project
TITLE Genetic determinants of micronucleus formation in vivo
JOURNAL Nature 627 (8002), 130-136 (2024)
PUBMED 38355793
REFERENCE 3 (bases 1 to 702)
AUTHORS Zhang,X., Yuan,S., Li,H., Zhan,J., Wang,F., Fan,J., Nie,X.,
Wang,Y., Wen,Z., Chen,Y., Chen,C. and Wang,D.W.
TITLE The double face of miR-320: cardiomyocytes-derived miR-320
deteriorated while fibroblasts-derived miR-320 protected against
heart failure induced by transverse aortic constriction
JOURNAL Signal Transduct Target Ther 6 (1), 69 (2021)
PUBMED 33597502
REMARK GeneRIF: The double face of miR-320: cardiomyocytes-derived miR-320
deteriorated while fibroblasts-derived miR-320 protected against
heart failure induced by transverse aortic constriction.
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 702)
AUTHORS Chal,J., Al Tanoury,Z., Oginuma,M., Moncuquet,P., Gobert,B.,
Miyanari,A., Tassy,O., Guevara,G., Hubaud,A., Bera,A., Sumara,O.,
Garnier,J.M., Kennedy,L., Knockaert,M., Gayraud-Morel,B.,
Tajbakhsh,S. and Pourquie,O.
TITLE Recapitulating early development of mouse musculoskeletal
precursors of the paraxial mesoderm in vitro
JOURNAL Development 145 (6) (2018)
PUBMED 29555813
REMARK Publication Status: Online-Only
REFERENCE 5 (bases 1 to 702)
AUTHORS Patoine,A., Husseini,A., Kasaai,B., Gaumond,M.H. and Moffatt,P.
TITLE The osteogenic cell surface marker BRIL/IFITM5 is dispensable for
bone development and homeostasis in mice
JOURNAL PLoS One 12 (9), e0184568 (2017)
PUBMED 28880886
REMARK Publication Status: Online-Only
REFERENCE 6 (bases 1 to 702)
AUTHORS Yang,G., Xu,Y., Chen,X. and Hu,G.
TITLE IFITM1 plays an essential role in the antiproliferative action of
interferon-gamma
JOURNAL Oncogene 26 (4), 594-603 (2007)
PUBMED 16847454
REMARK GeneRIF: The antiproliferative action of IFN-gamma requires the
induction of IFITM1.
REFERENCE 7 (bases 1 to 702)
AUTHORS Tanaka,S.S., Yamaguchi,Y.L., Tsoi,B., Lickert,H. and Tam,P.P.
TITLE IFITM/Mil/fragilis family proteins IFITM1 and IFITM3 play distinct
roles in mouse primordial germ cell homing and repulsion
JOURNAL Dev Cell 9 (6), 745-756 (2005)
PUBMED 16326387
REFERENCE 8 (bases 1 to 702)
AUTHORS Lickert,H., Cox,B., Wehrle,C., Taketo,M.M., Kemler,R. and
Rossant,J.
TITLE Dissecting Wnt/beta-catenin signaling during gastrulation using RNA
interference in mouse embryos
JOURNAL Development 132 (11), 2599-2609 (2005)
PUBMED 15857914
REMARK GeneRIF: Fragilis2 regulates epithelialization of the somites and
paraxial mesoderm formation.
REFERENCE 9 (bases 1 to 702)
AUTHORS Lange,U.C., Saitou,M., Western,P.S., Barton,S.C. and Surani,M.A.
TITLE The fragilis interferon-inducible gene family of transmembrane
proteins is associated with germ cell specification in mice
JOURNAL BMC Dev Biol 3, 1 (2003)
PUBMED 12659663
REFERENCE 10 (bases 1 to 702)
AUTHORS Tanaka,S.S. and Matsui,Y.
TITLE Developmentally regulated expression of mil-1 and mil-2, mouse
interferon-induced transmembrane protein like genes, during
formation and differentiation of primordial germ cells
JOURNAL Mech Dev 119 Suppl 1, S261-S267 (2002)
PUBMED 14516695
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
BY198144.1, BC090972.1 and AV136334.1.
Transcript Variant: This variant (2) represents the longest
transcript and encodes the longer isoform (a). Variants 1, 2, and 3
all encode the same isoform (a).
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BY198144.1, BC090972.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMN00849374, SAMN00849375
[ECO:0000348]
##Evidence-Data-END##
##RefSeq-Attributes-START##
RefSeq Select criteria :: based on conservation, expression,
longest protein
##RefSeq-Attributes-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-72 BY198144.1 1-72
73-700 BC090972.1 1-628
701-702 AV136334.1 298-299
FEATURES Location/Qualifiers
source 1..702
/organism="Mus musculus"
/mol_type="mRNA"
/strain="C57BL/6"
/db_xref="taxon:10090"
/chromosome="7"
/map="7 86.2 cM"
gene 1..702
/gene="Ifitm1"
/gene_synonym="1110036C17Rik; DSPA2a; Mil-2; Mil2"
/note="interferon induced transmembrane protein 1"
/db_xref="GeneID:68713"
/db_xref="MGI:MGI:1915963"
exon 1..363
/gene="Ifitm1"
/gene_synonym="1110036C17Rik; DSPA2a; Mil-2; Mil2"
/inference="alignment:Splign:2.1.0"
misc_feature 58..60
/gene="Ifitm1"
/gene_synonym="1110036C17Rik; DSPA2a; Mil-2; Mil2"
/note="upstream in-frame stop codon"
CDS 181..501
/gene="Ifitm1"
/gene_synonym="1110036C17Rik; DSPA2a; Mil-2; Mil2"
/note="isoform a is encoded by transcript variant 2;
interferon induced transmembrane protein 2 like;
fragilis2; fragilis protein 2; ifitm-like protein 2;
dispanin subfamily A member 2a"
/codon_start=1
/product="interferon-induced transmembrane protein 1
isoform a"
/protein_id="NP_001106186.1"
/db_xref="CCDS:CCDS21995.1"
/db_xref="GeneID:68713"
/db_xref="MGI:MGI:1915963"
/translation="
MPKEQQEVVVLGSPHISTSATATTINMPEISTPDHVVWSLFNTLFMNFCCLGFVAYAYSVKSRDRKMVGDTTGAQAFASTAKCLNISSLFFTILTAIVVIVVCAIR"
misc_feature 277..477
/gene="Ifitm1"
/gene_synonym="1110036C17Rik; DSPA2a; Mil-2; Mil2"
/note="Interferon-induced transmembrane protein; Region:
CD225; pfam04505"
/db_xref="CDD:461336"
misc_feature 433..495
/gene="Ifitm1"
/gene_synonym="1110036C17Rik; DSPA2a; Mil-2; Mil2"
/note="propagated from UniProtKB/Swiss-Prot (Q9D103.1);
transmembrane region"
exon 364..702
/gene="Ifitm1"
/gene_synonym="1110036C17Rik; DSPA2a; Mil-2; Mil2"
/inference="alignment:Splign:2.1.0"
ORIGIN
ttaactccgcagcccctaaaaagcacaccaaattgtaaacataaggaagtaggtttctgagaaacagaccccactggaggaaaaaggccggcccactgcgcagcaggctccggactgcccagtttgaaaagccttctcattccttccttattctcactctgcagcttcaaaagccgagagatgcctaaggagcagcaagaggtggttgtactggggtcaccccacatctcaacttctgcgacagccaccacaatcaacatgcctgagatctccacgcctgaccatgtggtctggtccctgttcaatacactcttcatgaacttctgctgcctgggcttcgtagcctatgcctactccgtgaagtctagggacaggaagatggtgggtgatacgactggggcccaggccttcgcctccaccgccaagtgcctgaacatcagctccctgttcttcaccatcctcacggccatcgtcgtcatcgttgtctgtgccattagatgatgtgagatgtcttgcaacatctcacagtagataacagattctggggcctcccaggcttgctatgtgtttccttgtctatcgctgccccaaaccctagacttagtcctgaccatttgccccatacatatgcaaatgtgacactcacaaatctgtccatggtggactcaataaagtgcacgtgctgtgactttctgcccctgg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]