GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-06 11:22:44, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_001102457             830 bp    mRNA    linear   ROD 07-AUG-2023
DEFINITION  Mus musculus reproductive homeobox 3C (Rhox3c), mRNA.
ACCESSION   NM_001102457
VERSION     NM_001102457.4
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 830)
  AUTHORS   MacLean,J.A. 2nd, Lorenzetti,D., Hu,Z., Salerno,W.J., Miller,J. and
            Wilkinson,M.F.
  TITLE     Rhox homeobox gene cluster: recent duplication of three family
            members
  JOURNAL   Genesis 44 (3), 122-129 (2006)
   PUBMED   16496311
REFERENCE   2  (bases 1 to 830)
  AUTHORS   Morris L, Gordon J and Blackburn CC.
  TITLE     Identification of a tandem duplicated array in the Rhox alpha locus
            on mouse chromosome X
  JOURNAL   Mamm Genome 17 (2), 178-187 (2006)
   PUBMED   16465597
REFERENCE   3  (bases 1 to 830)
  AUTHORS   Maclean JA 2nd, Chen MA, Wayne CM, Bruce SR, Rao M, Meistrich ML,
            Macleod C and Wilkinson MF.
  TITLE     Rhox: a new homeobox gene cluster
  JOURNAL   Cell 120 (3), 369-382 (2005)
   PUBMED   15707895
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL954686.9.
            
            On Dec 5, 2013 this sequence version replaced NM_001102457.3.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMN00849384,
                              SAMN01766820 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-181               AL954686.9         25711-25891
            182-551             AL954686.9         26142-26511
            552-597             AL954686.9         28381-28426
            598-830             AL954686.9         29572-29804
FEATURES             Location/Qualifiers
     source          1..830
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="X"
                     /map="X 21.76 cM"
     gene            1..830
                     /gene="Rhox3c"
                     /gene_synonym="EG665203; Rhox3.3; Rhox3b"
                     /note="reproductive homeobox 3C"
                     /db_xref="GeneID:100135654"
                     /db_xref="MGI:MGI:3770268"
     CDS             1..648
                     /gene="Rhox3c"
                     /gene_synonym="EG665203; Rhox3.3; Rhox3b"
                     /note="reproductive homeobox 3B"
                     /codon_start=1
                     /product="reproductive homeobox 3C"
                     /protein_id="NP_001095927.3"
                     /db_xref="CCDS:CCDS53054.1"
                     /db_xref="GeneID:100135654"
                     /db_xref="MGI:MGI:3770268"
                     /translation="
MSMKPERSISNWIHSNVERAGRNLFQVNGHRSALLPELPQDYHRASRSVYGCETKMDSTQGTKVLPAEEARNEEDGGQVESALGATAARGRGKEALNGESPAAAGTAGLVEEDRNKEDGGTKGGEKNEQEVREQIPEHVEGESDQAEAPRQVPRRRLHHRFTQWQLDELERIFRMNYFLSLEARKQLARWMGVNEAIVKRWFQKRREQYRWYKRL"
     misc_feature    463..633
                     /gene="Rhox3c"
                     /gene_synonym="EG665203; Rhox3.3; Rhox3b"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(463..477,481..483,532..534,550..552,589..591,
                     595..600,607..612,616..624,628..633)
                     /gene="Rhox3c"
                     /gene_synonym="EG665203; Rhox3.3; Rhox3b"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(469..471,478..480,598..600,607..612,619..621)
                     /gene="Rhox3c"
                     /gene_synonym="EG665203; Rhox3.3; Rhox3b"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            1..181
                     /gene="Rhox3c"
                     /gene_synonym="EG665203; Rhox3.3; Rhox3b"
                     /inference="alignment:Splign:2.1.0"
     exon            182..551
                     /gene="Rhox3c"
                     /gene_synonym="EG665203; Rhox3.3; Rhox3b"
                     /inference="alignment:Splign:2.1.0"
     exon            552..597
                     /gene="Rhox3c"
                     /gene_synonym="EG665203; Rhox3.3; Rhox3b"
                     /inference="alignment:Splign:2.1.0"
     exon            598..830
                     /gene="Rhox3c"
                     /gene_synonym="EG665203; Rhox3.3; Rhox3b"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atgagcatgaagccagaacgttccatctctaactggatacatagtaatgtggaacgggctggaagaaatctcttccaggtcaacggtcaccgctctgctctattaccggaactacctcaggattaccacagagcttcaagatcagtctacggatgtgagactaaaatggacagcacccaaggtaccaaggttttgccggctgaagaggcaagaaatgaggaagatggaggacaggtggagtcggcattgggagccacagccgcaaggggtagaggaaaagaagcattaaatggagagagtcccgccgctgctggcactgcaggccttgtagaggaagacaggaacaaggaagatggtggcaccaagggaggtgagaagaatgagcaggaagtgagggagcagattcctgagcatgttgaaggagagagtgaccaggctgaagcaccaaggcaggtgccacgacgtcgattgcaccatagattcacccagtggcagctggacgaactggagagaattttccggatgaattattttctcagtctagaagcaagaaaacaactggcccgatggatgggtgtgaatgaagccatagtgaagagatggtttcagaagaggagagaacaatacaggtggtataagaggctataaggtctcagaagttctcctcctgcttctcagaacatctttcctgaagactgtggaggaaccctgcagtgccactatcgccaaggcaacatagagagaggaatttttttcgtttcctaacgatatgttattaaactcttatatctgaagcgattatatttcaataacaatatgaattttcaata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]