GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-21 10:24:54, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_001040089             833 bp    mRNA    linear   ROD 07-AUG-2023
DEFINITION  Mus musculus reproductive homeobox 3F (Rhox3f), mRNA.
ACCESSION   NM_001040089 NM_001085351 XM_885563 XM_896250
VERSION     NM_001040089.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 833)
  AUTHORS   MacLean,J.A. 2nd, Lorenzetti,D., Hu,Z., Salerno,W.J., Miller,J. and
            Wilkinson,M.F.
  TITLE     Rhox homeobox gene cluster: recent duplication of three family
            members
  JOURNAL   Genesis 44 (3), 122-129 (2006)
   PUBMED   16496311
REFERENCE   2  (bases 1 to 833)
  AUTHORS   Morris L, Gordon J and Blackburn CC.
  TITLE     Identification of a tandem duplicated array in the Rhox alpha locus
            on mouse chromosome X
  JOURNAL   Mamm Genome 17 (2), 178-187 (2006)
   PUBMED   16465597
REFERENCE   3  (bases 1 to 833)
  AUTHORS   Maclean JA 2nd, Chen MA, Wayne CM, Bruce SR, Rao M, Meistrich ML,
            Macleod C and Wilkinson MF.
  TITLE     Rhox: a new homeobox gene cluster
  JOURNAL   Cell 120 (3), 369-382 (2005)
   PUBMED   15707895
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL808133.17 and BC145759.1.
            
            On May 26, 2010 this sequence version replaced NM_001040089.2.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY147207.1, BC145759.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849384 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-130               AL808133.17        61150-61279
            131-720             BC145759.1         1-590
            721-833             AL808133.17        65182-65294
FEATURES             Location/Qualifiers
     source          1..833
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="X"
                     /map="X 21.88 cM"
     gene            1..833
                     /gene="Rhox3f"
                     /gene_synonym="Rhox3.6; Rhox3e"
                     /note="reproductive homeobox 3F"
                     /db_xref="GeneID:621852"
                     /db_xref="MGI:MGI:3770277"
     CDS             1..648
                     /gene="Rhox3f"
                     /gene_synonym="Rhox3.6; Rhox3e"
                     /note="reproductive homeobox 3E; PEPP subfamily member"
                     /codon_start=1
                     /product="reproductive homeobox 3F"
                     /protein_id="NP_001035178.3"
                     /db_xref="CCDS:CCDS53058.1"
                     /db_xref="GeneID:621852"
                     /db_xref="MGI:MGI:3770277"
                     /translation="
MSMKPERSMSNWIHSNVEPAGRNLFQVNGHRSALLPELPQDYHRASRSVNGCETKMDNTQGTKVLPAEEARNEEDGGQVESALGATAARGRGKEALNGESPAAAGTAGLVEEDRNKEDGGTKGGEKNEQEVREQIPEHVEGESDQAEALRQVPRRRLHHRFTQWQLDELERIFRMNYFLSLEARKQLARWMGVNEAIVKRWFQKRREKYRWYKRL"
     misc_feature    463..630
                     /gene="Rhox3f"
                     /gene_synonym="Rhox3.6; Rhox3e"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            1..181
                     /gene="Rhox3f"
                     /gene_synonym="Rhox3.6; Rhox3e"
                     /inference="alignment:Splign:2.1.0"
     exon            182..551
                     /gene="Rhox3f"
                     /gene_synonym="Rhox3.6; Rhox3e"
                     /inference="alignment:Splign:2.1.0"
     exon            552..597
                     /gene="Rhox3f"
                     /gene_synonym="Rhox3.6; Rhox3e"
                     /inference="alignment:Splign:2.1.0"
     exon            598..833
                     /gene="Rhox3f"
                     /gene_synonym="Rhox3.6; Rhox3e"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atgagcatgaagccagaacgttccatgtctaactggatacatagtaatgtggaaccggctggaagaaatctcttccaggtcaacggtcaccgctctgctctattaccggaactacctcaggattaccacagagcttcaaggtcagtcaacggatgtgagactaaaatggacaacacccaaggtaccaaggttttgccggctgaagaggcaagaaatgaggaagatggaggacaggtcgagtcggcattgggagccacagccgcaaggggtagaggaaaagaagcattaaatggagagagtcccgccgctgctggcactgcaggccttgtagaggaagacaggaacaaggaagatggtggcaccaagggaggtgagaagaatgagcaggaagtgagggagcagattcctgagcatgttgaaggagagagtgaccaggctgaagcgctaaggcaggtgccacgacgtcgattgcaccatagattcacccagtggcagctggacgaactggagagaattttccggatgaattattttctcagtctagaagcaagaaaacaactggcccgatggatgggtgtgaatgaagccatagtgaagagatggtttcagaagaggagagaaaaatacaggtggtataagaggctataaggtctcagaagttctcctcctgcttctcagaacatctttcatgaagactgtggaggaaccctgcagtgcaaatattaccaaggcaacagagagaaatgaattgctttcttctcctaacaatatgttattaaactcttatatctgaagcgattatatttcaataacaatatgaattttcaatataa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]