2025-09-17 03:52:35, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS NM_001040089 833 bp mRNA linear ROD 07-AUG-2023 DEFINITION Mus musculus reproductive homeobox 3F (Rhox3f), mRNA. ACCESSION NM_001040089 NM_001085351 XM_885563 XM_896250 VERSION NM_001040089.3 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 833) AUTHORS MacLean,J.A. 2nd, Lorenzetti,D., Hu,Z., Salerno,W.J., Miller,J. and Wilkinson,M.F. TITLE Rhox homeobox gene cluster: recent duplication of three family members JOURNAL Genesis 44 (3), 122-129 (2006) PUBMED 16496311 REFERENCE 2 (bases 1 to 833) AUTHORS Morris L, Gordon J and Blackburn CC. TITLE Identification of a tandem duplicated array in the Rhox alpha locus on mouse chromosome X JOURNAL Mamm Genome 17 (2), 178-187 (2006) PUBMED 16465597 REFERENCE 3 (bases 1 to 833) AUTHORS Maclean JA 2nd, Chen MA, Wayne CM, Bruce SR, Rao M, Meistrich ML, Macleod C and Wilkinson MF. TITLE Rhox: a new homeobox gene cluster JOURNAL Cell 120 (3), 369-382 (2005) PUBMED 15707895 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AL808133.17 and BC145759.1. On May 26, 2010 this sequence version replaced NM_001040089.2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##Evidence-Data-START## Transcript exon combination :: AY147207.1, BC145759.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849384 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-130 AL808133.17 61150-61279 131-720 BC145759.1 1-590 721-833 AL808133.17 65182-65294 FEATURES Location/Qualifiers source 1..833 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="X" /map="X 21.88 cM" gene 1..833 /gene="Rhox3f" /gene_synonym="Rhox3.6; Rhox3e" /note="reproductive homeobox 3F" /db_xref="GeneID:621852" /db_xref="MGI:MGI:3770277" CDS 1..648 /gene="Rhox3f" /gene_synonym="Rhox3.6; Rhox3e" /note="reproductive homeobox 3E; PEPP subfamily member" /codon_start=1 /product="reproductive homeobox 3F" /protein_id="NP_001035178.3" /db_xref="CCDS:CCDS53058.1" /db_xref="GeneID:621852" /db_xref="MGI:MGI:3770277" /translation="
MSMKPERSMSNWIHSNVEPAGRNLFQVNGHRSALLPELPQDYHRASRSVNGCETKMDNTQGTKVLPAEEARNEEDGGQVESALGATAARGRGKEALNGESPAAAGTAGLVEEDRNKEDGGTKGGEKNEQEVREQIPEHVEGESDQAEALRQVPRRRLHHRFTQWQLDELERIFRMNYFLSLEARKQLARWMGVNEAIVKRWFQKRREKYRWYKRL"
misc_feature 463..630 /gene="Rhox3f" /gene_synonym="Rhox3.6; Rhox3e" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" exon 1..181 /gene="Rhox3f" /gene_synonym="Rhox3.6; Rhox3e" /inference="alignment:Splign:2.1.0" exon 182..551 /gene="Rhox3f" /gene_synonym="Rhox3.6; Rhox3e" /inference="alignment:Splign:2.1.0" exon 552..597 /gene="Rhox3f" /gene_synonym="Rhox3.6; Rhox3e" /inference="alignment:Splign:2.1.0" exon 598..833 /gene="Rhox3f" /gene_synonym="Rhox3.6; Rhox3e" /inference="alignment:Splign:2.1.0" ORIGIN
atgagcatgaagccagaacgttccatgtctaactggatacatagtaatgtggaaccggctggaagaaatctcttccaggtcaacggtcaccgctctgctctattaccggaactacctcaggattaccacagagcttcaaggtcagtcaacggatgtgagactaaaatggacaacacccaaggtaccaaggttttgccggctgaagaggcaagaaatgaggaagatggaggacaggtcgagtcggcattgggagccacagccgcaaggggtagaggaaaagaagcattaaatggagagagtcccgccgctgctggcactgcaggccttgtagaggaagacaggaacaaggaagatggtggcaccaagggaggtgagaagaatgagcaggaagtgagggagcagattcctgagcatgttgaaggagagagtgaccaggctgaagcgctaaggcaggtgccacgacgtcgattgcaccatagattcacccagtggcagctggacgaactggagagaattttccggatgaattattttctcagtctagaagcaagaaaacaactggcccgatggatgggtgtgaatgaagccatagtgaagagatggtttcagaagaggagagaaaaatacaggtggtataagaggctataaggtctcagaagttctcctcctgcttctcagaacatctttcatgaagactgtggaggaaccctgcagtgcaaatattaccaaggcaacagagagaaatgaattgctttcttctcctaacaatatgttattaaactcttatatctgaagcgattatatttcaataacaatatgaattttcaatataa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]