2025-07-09 14:41:05, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001025086 983 bp mRNA linear ROD 04-AUG-2023 DEFINITION Mus musculus reproductive homeobox 7A (Rhox7a), mRNA. ACCESSION NM_001025086 XM_622029 VERSION NM_001025086.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 983) AUTHORS Wilming LG, Boychenko V and Harrow JL. TITLE Comprehensive comparative homeobox gene annotation in human and mouse JOURNAL Database (Oxford) 2015 (2015) PUBMED 26412852 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 983) AUTHORS Daggag H, Svingen T, Western PS, van den Bergen JA, McClive PJ, Harley VR, Koopman P and Sinclair AH. TITLE The rhox homeobox gene family shows sexually dimorphic and dynamic expression during mouse embryonic gonad development JOURNAL Biol Reprod 79 (3), 468-474 (2008) PUBMED 18562707 REFERENCE 3 (bases 1 to 983) AUTHORS Maclean JA 2nd, Chen MA, Wayne CM, Bruce SR, Rao M, Meistrich ML, Macleod C and Wilkinson MF. TITLE Rhox: a new homeobox gene cluster JOURNAL Cell 120 (3), 369-382 (2005) PUBMED 15707895 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AL590629.16. On Sep 7, 2007 this sequence version replaced NM_001025086.1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. ##Evidence-Data-START## Transcript exon combination :: DQ058644.1 [ECO:0000332] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-80 AL590629.16 17022-17101 81-184 AL590629.16 18344-18447 185-230 AL590629.16 19568-19613 231-300 AL590629.16 21013-21082 301-668 AL590629.16 23488-23855 669-820 AL590629.16 24553-24704 821-866 AL590629.16 25328-25373 867-983 AL590629.16 26391-26507 FEATURES Location/Qualifiers source 1..983 /organism="Mus musculus" /mol_type="mRNA" /db_xref="taxon:10090" /chromosome="X" /map="X 22.08 cM" gene 1..983 /gene="Rhox7a" /gene_synonym="Gm712; Rhox7" /note="reproductive homeobox 7A" /db_xref="GeneID:547168" /db_xref="MGI:MGI:3580246" exon 1..80 /gene="Rhox7a" /gene_synonym="Gm712; Rhox7" /inference="alignment:Splign:2.1.0" exon 81..184 /gene="Rhox7a" /gene_synonym="Gm712; Rhox7" /inference="alignment:Splign:2.1.0" CDS 138..983 /gene="Rhox7a" /gene_synonym="Gm712; Rhox7" /note="reproductive homeobox on X chromosome 7; reproductive homeobox on chromosome X, 7" /codon_start=1 /product="reproductive homeobox 7" /protein_id="NP_001020257.2" /db_xref="CCDS:CCDS30081.1" /db_xref="GeneID:547168" /db_xref="MGI:MGI:3580246" /translation="
METMFQETQYPDVLTREVLARSMDGSEAKVQIRFNNRRAKQRAREKKAMLRSTAGAKAPLVLPAGEERNGEDSRDQSSPGLGASAAEWGGVEGPGELGRKEKNGASPSAVDTSGVRGDWTQKGASGSSQKNERRPQNRVPECRWGTEDVHPVPVLVPRAQRRQRVGSRSRGQSVSLKCPRIRPVLVSTVQPVPVLVPHRPLRDGFTEPQLQELEQVFQRNHYLRAEEGKQLARGTGVTEAKLQRWFKKRRVQFRREHSQSRMNDDAPPRTHSTSLKMAQEP"
misc_feature <138..263 /gene="Rhox7a" /gene_synonym="Gm712; Rhox7" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" misc_feature 741..908 /gene="Rhox7a" /gene_synonym="Gm712; Rhox7" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:238039" misc_feature order(741..746,750..752,801..803,819..821,858..860, 864..869,876..881,885..893,897..902) /gene="Rhox7a" /gene_synonym="Gm712; Rhox7" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(747..749,867..869,876..881,888..890) /gene="Rhox7a" /gene_synonym="Gm712; Rhox7" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" exon 185..230 /gene="Rhox7a" /gene_synonym="Gm712; Rhox7" /inference="alignment:Splign:2.1.0" exon 231..300 /gene="Rhox7a" /gene_synonym="Gm712; Rhox7" /inference="alignment:Splign:2.1.0" exon 301..668 /gene="Rhox7a" /gene_synonym="Gm712; Rhox7" /inference="alignment:Splign:2.1.0" exon 669..820 /gene="Rhox7a" /gene_synonym="Gm712; Rhox7" /inference="alignment:Splign:2.1.0" exon 821..866 /gene="Rhox7a" /gene_synonym="Gm712; Rhox7" /inference="alignment:Splign:2.1.0" exon 867..983 /gene="Rhox7a" /gene_synonym="Gm712; Rhox7" /inference="alignment:Splign:2.1.0" ORIGIN
ataatcaccgagttctcacggagggggtcaaccgtggcaactcggagagaaagagcgatgggttcactagggatccccagcgccagggcaggaggcaccagatccagttcaccttcacaccctggcaagtgcaggagatggagaccatgttccaagagactcagtacccagatgtgcttacaagagaggtgcttgccagaagcatggatgggtctgaagccaaggtgcagataaggtttaacaacaggagagccaaacagagggccagggagaagaaagcaatgctcaggagcacagcaggtgcaaaagcccccctggtcttgcctgctggtgaggaaagaaatggggaagattcacgtgaccagtcctcccctggactgggagcctctgcagcagaatggggcggagtagaaggaccaggggaactggggagaaaggagaagaatggagccagtccttctgctgtagacacctctggcgtcaggggtgactggacccaaaagggggccagcggcagtagccagaaaaatgagcgtcggcctcagaatcgggtccctgagtgtaggtggggcactgaggacgtgcaccctgtgccagtgctggtgcctcgtgcccagcggaggcagcgtgtgggatcccgatcccggggacagtctgtgtctctaaagtgcccccgcatacggccagttttggtgtccactgtacagcctgtgccagtgctggtgccccaccgccccctccgggacggatttacagagccacagctgcaggagctggaacaggttttccagagaaaccactatctccgtgctgaagaaggaaaacagctggcaaggggaacgggtgtgactgaggccaagttgcagagatggtttaagaagaggagagtgcagttcaggagagaacacagtcagtcaaggatgaatgatgatgccccacccaggacccactccacctctctgaagatggcgcaggagccctag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]