GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 20:40:45, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_005818030             369 bp    RNA     linear   VRT 08-APR-2021
DEFINITION  PREDICTED: Cygnus olor uncharacterized LOC121066939 (LOC121066939),
            ncRNA.
ACCESSION   XR_005818030
VERSION     XR_005818030.1
DBLINK      BioProject: PRJNA642912
KEYWORDS    RefSeq.
SOURCE      Cygnus olor (mute swan)
  ORGANISM  Cygnus olor
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Anseriformes;
            Anatidae; Anserinae; Cygnus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_049171.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Cygnus olor Annotation Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..369
                     /organism="Cygnus olor"
                     /mol_type="transcribed RNA"
                     /isolate="bCygOlo1"
                     /db_xref="taxon:8869"
                     /chromosome="3"
                     /sex="male"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /country="Germany: Mainau"
                     /lat_lon="50.149850 N 11.063270 E"
                     /collection_date="2015-07-01"
                     /collected_by="Robert Kraus"
     gene            1..369
                     /gene="LOC121066939"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:121066939"
     ncRNA           1..369
                     /ncRNA_class="lncRNA"
                     /gene="LOC121066939"
                     /product="uncharacterized LOC121066939"
                     /db_xref="GeneID:121066939"
ORIGIN      
agacacacctgatgatttattattttcagtagcttatttgtgaatatgaaaaaatgtctttcttgatattcaccaaatgatataaatgcctttactctccagctcttcattttttctgctcactggtgctttgaatgcagtggaaaggcatttctggtctccatggcttctcttaaatgcacgcagagaagggaacataatagagatgatgagccctagcaaattagccaactgcaatctcttcttgttcagttaacgcgcctgtacagccagataccagccacgggagcaaagggctgtgagaggagatttggagcccaagtataggagtagagaagctctcagctgtttgtagcatgtctagaagca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]