GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 18:08:59, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_037860603             513 bp    mRNA    linear   INV 20-NOV-2020
DEFINITION  PREDICTED: Drosophila subpulchrella uncharacterized LOC119551309
            (LOC119551309), mRNA.
ACCESSION   XM_037860603
VERSION     XM_037860603.1
DBLINK      BioProject: PRJNA668122
KEYWORDS    RefSeq.
SOURCE      Drosophila subpulchrella
  ORGANISM  Drosophila subpulchrella
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Diptera; Brachycera;
            Muscomorpha; Ephydroidea; Drosophilidae; Drosophila; Sophophora.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_050611.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Drosophila subpulchrella Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..513
                     /organism="Drosophila subpulchrella"
                     /mol_type="mRNA"
                     /strain="33 F10 #4"
                     /db_xref="taxon:1486046"
                     /chromosome="2R"
                     /sex="female"
                     /tissue_type="whole-body"
                     /dev_stage="adult"
                     /breed="RU33"
     gene            1..513
                     /gene="LOC119551309"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 3 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:119551309"
     CDS             68..457
                     /gene="LOC119551309"
                     /codon_start=1
                     /product="uncharacterized protein LOC119551309"
                     /protein_id="XP_037716531.1"
                     /db_xref="GeneID:119551309"
                     /translation="
MIYSENCCCCIELKCFCILIAIVEVLIRGLDRFFVDRDSILGFLSLVVSGIYVICCIFLLLGAVLGVRYFLLPYLSVSCLRFLILVAEGVFVATEGFVNEYLVFDVLQSLLGLYFWLVVFSYYDLLKDT"
ORIGIN      
ctgttgtaagtcagttggccaggcggggaacatctgagactgctttagaaatcccaccgaaccaaaaatgatctattcggagaattgctgttgctgcatagagctgaagtgcttctgcatcctgatagccatcgtggaggtgctcatccgcgggttggatcgtttttttgtggatcgcgacagcatcctgggatttttgtccctcgtggtgagcggtatctacgtaatctgctgcatattccttcttcttggagccgtgctgggggtaaggtactttctgttgccctacctctcggtttcctgcctccgcttccttattttggttgccgagggcgtgtttgtggccacggaaggcttcgtcaatgaatatcttgtcttcgatgttctccaatctcttcttggtctatacttttggctggtggtcttctcctactacgatctgttgaaggacacctgagtttatatatttgtgcttacttttatattgtaaaaaatacttgtttagatctgagt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]