2024-05-19 20:53:09, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_034148409 1486 bp mRNA linear VRT 06-MAY-2020 DEFINITION PREDICTED: Trematomus bernacchii all-trans-retinol 13,14-reductase-like (LOC117496684), mRNA. ACCESSION XM_034148409 VERSION XM_034148409.1 DBLINK BioProject: PRJNA629536 KEYWORDS RefSeq; includes ab initio. SOURCE Trematomus bernacchii (emerald rockcod) ORGANISM Trematomus bernacchii Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Eupercaria; Perciformes; Notothenioidei; Nototheniidae; Trematomus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_022987767.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Trematomus bernacchii Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 7% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..1486 /organism="Trematomus bernacchii" /mol_type="mRNA" /db_xref="taxon:40690" /chromosome="Unknown" gene 1..1486 /gene="LOC117496684" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 96% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:117496684" CDS 1..714 /gene="LOC117496684" /codon_start=1 /product="all-trans-retinol 13,14-reductase-like" /protein_id="XP_034004300.1" /db_xref="GeneID:117496684" /translation="
MGAACAKSEMFFGKFKWPLFSQYLLVRAIEIKCVCTLLNILFIGLFHIISGVPPKESSFLINALLLQHYKRGAYYSQGGASEFAFHIINVIEKAGGAVLVRAPVHRVLLNRQNKAYGVTVLKGQEEIEVHAPVVISNAGIFNIFEKFLPQPIQEKPGVPPKESSFLINALLLQHYKRGAYYSRGAPVCLPSTSSMSLRRRAVLFSSGLRYTASCSTGRTRPMVGKELQTSSGIQLLF"
misc_feature <148..>423 /gene="LOC117496684" /note="Phytoene dehydrogenase-related protein [Secondary metabolites biosynthesis, transport and catabolism]; Region: COG1233" /db_xref="CDD:224154" ORIGIN
atgggagcggcctgtgcaaagtcagagatgttttttggcaagtttaaatggcccttattttctcaatatttactggtccgggccatagagatcaaatgtgtctgtacgctgctcaatatcctcttcattggtctatttcatatcatttcaggtgtccctcctaaagagtccagctttctgatcaatgctctccttcttcaacactacaagcgtggtgcctactactcacaggggggcgccagtgagtttgccttccacatcatcaatgtcattgagaaggcgggcggtgctgttctcgtcagggctccggtacaccgcgtcctgctcaaccggcagaacaaggcctatggtgtgacggtgctcaaaggacaagaagagattgaggtccatgcccctgttgtcatttctaatgctggcattttcaacatattcgagaagtttctacctcagcccatacaggagaaaccaggtgtccctcctaaagagtccagctttctgatcaatgctctccttcttcaacactacaagcgtggtgcgtactactcacggggggcgccagtgtgtttgccttccacatcatcaatgtcattgagaaggcgggcggtgctgttctcgtcagggctccggtacaccgcgtcctgctcaaccggcagaacaaggcctatggtgggaaaagagttgcagacgagttctggaatacagttgcttttttgaatgagaccgtgcaaaggttgacctgttcatggagctcatgagacattctttcacacttttatcagtcttctaagcagagctatgtctttttgggctccaagccagaacagagattggaagtcggttgcatcacttcccgctttgttaaccgcttttcaaaacactctagaaattgttactaggctagaaccaaaacaaaaatgaggcaccagttttcaagcattttttggagttgggtgaacttctgcatttttaggagttggttaaacttaccaatattgtcattatcttagtttgttacacctgtttcctttattttctaattttcttgtctgcttttacttcctgtctttgtaattgttgattccttccacctgtgtgtgatctccagctttgttaatgttataagtatactgttcctatatatgtttaagtgttgatcattttatttggtactttcccttttttgcacttgcctgctttttagttttgtgtttttgtaaccagctttgatttgataaagctcgattttggtttttcatacctgcctcccctcttttgaactgcttttaaggccttatttccttacccttggtgctttaaggctgaaacatgcactgatgttattttacgtatgattaacactttgtgtgtgtgtgtcaggtgtgacggtgctcaaaggacaagaagagattgaggtccatgcccctgttgtcatttctaatgctggcattttcaacatattcgagaagtttctacctcagcccataca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]