LOCUS       XR_008488766            3151 bp    RNA     linear   PRI 26-AUG-2024
DEFINITION  PREDICTED: Homo sapiens POU class 4 homeobox 1 (POU4F1), transcript
            variant X1, misc_RNA.
ACCESSION   XR_008488766
VERSION     XR_008488766.1
DBLINK      BioProject: PRJNA807723
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_060937) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_009914755.1-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/23/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3151
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /isolate="CHM13"
                     /db_xref="taxon:9606"
                     /chromosome="13"
                     /sex="female"
                     /cell_line="CHM13htert"
                     /tissue_type="hydatidiform mole"
                     /note="haploid cell line"
     gene            1..3151
                     /gene="POU4F1"
                     /gene_synonym="ATITHS; brn-3A; BRN3A; Oct-T1; RDC-1"
                     /note="POU class 4 homeobox 1; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 1 EST,
                     26 long SRA reads, 2 Proteins, and 83% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     4 samples with support for all annotated introns"
                     /db_xref="GeneID:5457"
                     /db_xref="HGNC:HGNC:9218"
                     /db_xref="MIM:601632"
     misc_RNA        1..3151
                     /gene="POU4F1"
                     /gene_synonym="ATITHS; brn-3A; BRN3A; Oct-T1; RDC-1"
                     /product="POU class 4 homeobox 1, transcript variant X1"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
                     /db_xref="GeneID:5457"
                     /db_xref="HGNC:HGNC:9218"
                     /db_xref="MIM:601632"
ORIGIN      

tctccgaaacgctgcatgtcgggggctggtgtgtgcaggtcccggtgcggggaactgcgggcagggggtgtagagcagtcccgcagcgaggcacgttttgtccggcggcccttaatgtcgtgttcctgtctgcctctgcctccgcgtcaggcgcctgcgatcggagtagggagcgctggggccaggactctcgacttccctctactttctctgttaatttcacgcctcagaaaggcagtctctgtgcgtgctcgggtgtgtgacacgggtccccagctgcgagttacatttccatttcttcttttccctctttttcgtctcccacgcccgtttccggaatgtgttcttgtgtccccctttctccctacttctgtccccctctccacgctcccatcccttctcgtctgccccctccctggtcgtcaatgtgccccctctccgtctttcccgctctccactgcccccaaacccgttgttattttggttgctttgtgtttgcccttcgcatgctgtgctttccggcctgtgtgtgtgtttcttctgttgttttgttttgctcttttggttttgtggtttttttggtttggtttgtgtcgcctgcagctgcagagcaacctcttcgccagcctggacgagacgctgctggcgcgggccgaggcgctggcggccgtggacatcgccgtgtcccagggcaagagccatcctttcaagccggacgccacgtaccacacgatgaacagcgtgccgtgcacgtccacttccacggtgcctctggcgcaccaccaccaccaccaccaccaccaccaggcgctcgaacccggcgatctgctggaccacatctcctcgccgtcgctcgcgctcatggccggcgcgggcggcgcgggcgcggcggccggcggcggcggcgcccacgacggcccggggggcggtggcggcccgggcggcggcggcggcccgggcggcggcggccccgggggaggcggcggtggcggcccggggggcggcggcggcggcccgggcggcgggctcctgggcggctccgcgcaccctcacccgcatatgcacagcctgggccacctgtcgcaccccgcggcggcggccgccatgaacatgccgtccgggctgccgcaccccgggctggtggcggcggcggcgcaccacggcgcggcagcggcagcggcggcggcggcggccgggcaggtggcagcggcatcggcggcggcggccgtggtgggcgcagcgggcctggcgtccatctgcgactcggacacggacccgcgcgagctcgaggcgttcgcggagcgcttcaagcagcggcgcatcaagctgggcgtgacgcaggccgacgtgggctcggcgctggccaacctcaagatcccgggcgtgggctcactcagccagagcaccatctgcaggttcgagtcgctcacgctctcgcacaacaacatgatcgcgctcaagcccatcctgcaggcgtggctcgaggaggccgagggcgcccagcgcgagaaaatgaacaagcctgagctcttcaacggcggcgagaagaagcgcaagcggacttccatcgccgcgcccgagaagcgctccctcgaggcctacttcgccgtgcagccccggccctcgtccgagaagatcgccgccatcgccgagaaactggacctcaaaaagaacgtggtgcgggtgtggttttgcaaccagagacagaagcagaagcggatgaaattctctgccacttactgagggggctgggaggtgtcgggcgggacagaatggggagctgaggaggcatttttggggggctttcctctgcttgcctcccctcggatttggagtgtccgttatcctgcctgcatttggggagtcccttctcgctctctttcctccacccattctctgattttcctgcctttgctgtcccctagccttgaggactggggtgctgggtgtggggattggagtatagggtaggggagaagggggggagcattcgggggagtggggagtggggggaaggaaagcggagacccgagcaggggttttaaggagcaggatggttctggggtttgggtggggggagacgcgggaagggtaggaaaatggactgtttctgaccagagacacttacctaaatatcctggggaccaaggaactatgtacaaaaacaaacctaccaaccaccaaaaactagacaaataaagacaaactaaaacaaaacagaacaaaagcaaaggaaaatgctttagaaattttaactccggggagccataatctgcaacttcattttcccccatagaagagaaaaaagagcaccaccattattaccacctccccaaccctacacgcacgaactgagtcgaaaaacgaaaaccaaacgagcgagaagttgaagttctgggtcccgtttcttcctctcttggaggacatgaaattatagaaatgttgagaagttcctgctttcttttgcggtaggacttggctgtgagaaaatcacctaaatcccagaaaagaggaagacagatttaaagtgcccccacccccatttgtttcaaagaggtctgcatgttgggcgaaaacagaacaactgtgtttccttttacttgttcttattattcaagagtcatttattacaggggataaatgttgggtagcaagaactttaatttgcactaccagtctcccaaatagaaaatcatgtatagtatttcatagtaataatcaggtaccttacaagctgctggtggattttaaaaaattaagatagttgaaggtggttaggtaaaatgcctgctttgtgtacaagatactctttggatctctcgtagagatggtttgttaccatcctttaatcataactaaaacattgaaaacagaacaaatgagaaaagaaaaaaaacctgccgattaacaagactgaaatcatgcatgatctgaaaggtgtggaaagaaacacaattaggtctcactctggttaggcattatttatttaattatgttgtatatcattgtttgcagggcaaacattctatgcatttgaaactgagcactaaactgggctagctttctggtagaccgttttgtggctagtgcgatttcacagtctactgcctgtttccactgaaaacatttttgtcatattcttgtattcaaa

//