LOCUS       XM_054379666            1331 bp    mRNA    linear   PRI 26-AUG-2024
DEFINITION  PREDICTED: Homo sapiens GSG1 like (GSG1L), transcript variant X1,
            mRNA.
ACCESSION   XM_054379666
VERSION     XM_054379666.1
DBLINK      BioProject: PRJNA807723
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_060940) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_009914755.1-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/23/2024
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 21% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1331
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /isolate="CHM13"
                     /db_xref="taxon:9606"
                     /chromosome="16"
                     /sex="female"
                     /cell_line="CHM13htert"
                     /tissue_type="hydatidiform mole"
                     /note="haploid cell line"
     gene            1..1331
                     /gene="GSG1L"
                     /gene_synonym="PRO19651"
                     /note="GSG1 like; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 1 EST, 1 long SRA read,
                     and 83% coverage of the annotated genomic feature by
                     RNAseq alignments, including 3 samples with support for
                     all annotated introns"
                     /db_xref="GeneID:146395"
                     /db_xref="HGNC:HGNC:28283"
                     /db_xref="MIM:617161"
     CDS             291..1316
                     /gene="GSG1L"
                     /gene_synonym="PRO19651"
                     /codon_start=1
                     /product="germ cell-specific gene 1-like protein isoform
                     X1"
                     /protein_id="XP_054235641.1"
                     /db_xref="GeneID:146395"
                     /db_xref="HGNC:HGNC:28283"
                     /db_xref="MIM:617161"
                     /translation="

MKTSRRGRALLAVALNLLALLFATTAFLTTHWCQGTQRVPKPGCGQGGRANCPNSGANATANGTAAPAAAAAAATASGNGPPGGALYSWETGDDRFLFRNFHTGIWYSCEEELSGLGEKCRSFIDLAPASEKGVLWLSVVSEVLYILLLVVGFSLMCLELFHSSNVIDGLKLNAFAAVFTVLSGLLGMVAHMMYTQVFQVTVSLGPEDWRPHSWDYGWSFCLAWGSFTCCMAASVTTLNSYTKTVIEFRHKRKVFEQGYREEPTFIDPEAIKYFRERMEKRDGSEEDFHLDCRHERYPAPWRASWKRGSETRGWMCLENSCCRDNRVKKSSETGSGSTQQG"

     misc_feature    360..686
                     /gene="GSG1L"
                     /gene_synonym="PRO19651"
                     /note="GSG1-like protein; Region: GSG-1; pfam07803"
                     /db_xref="CDD:462270"
     misc_feature    <594..995
                     /gene="GSG1L"
                     /gene_synonym="PRO19651"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:473919"
ORIGIN      

aggcgccagcggctcctagccgaggtgcactcgcgctccgggctccgggcgcgccgtagccgctcctccaccgccgcccgccccgccagcccgccccgcacgccccccgcgccgcgcccccaccccggggttggggggggcatgggcccgcgccgcgtccgccgccgccgatctcaggcacccgagccccggggcgcggcgggcagcggccgctgacgcggggcgccagctgccaacttcgcgcgcggagctccccggcggtgcagtcccgtcccggcggcgcgggcggcatgaagactagccgccgcggccgagcgctcctggccgtggccctgaacctgctggcgctgctgttcgccaccaccgctttcctcaccacgcactggtgccagggcacgcagcgggtccccaagccgggctgcggccagggcgggcgcgccaactgccccaactcgggcgccaacgccacggccaacggcaccgccgcccccgccgccgccgccgccgccgccaccgcctcggggaacggcccccctggcggcgcgctctacagctgggagaccggcgacgaccgcttcctcttcaggaatttccacaccggcatctggtactcgtgcgaggaggagctcagcgggcttggtgaaaaatgtcgcagcttcattgacctggccccggcgtcggagaaaggggtcctgtggctgtctgtggtctccgaggtgctgtacattctgctgctggtggttggcttcagcctcatgtgtctcgagctcttccactccagcaatgtcatcgacgggctcaagctcaatgccttcgcggctgtcttcacggtgctctcaggcctcctgggaatggtcgcccacatgatgtacacgcaggtgttccaggtcaccgtgagcctcggtcctgaggactggagaccccattcctgggactacgggtggtccttctgcctggcgtggggctcctttacctgctgcatggcagcctctgtcaccacgctcaactcctacaccaagacggtcattgagttccggcacaagcgcaaggtctttgagcagggctaccgggaagagccgaccttcatagaccctgaggccatcaagtacttccgggagaggatggagaagagggacgggagcgaggaggactttcacttagactgccgccacgagagataccctgccccttggagggcttcctggaagaggggatcagaaaccaggggatggatgtgtttggagaactcctgctgcagggacaacagagtgaagaaatcatcagagacgggctcgggaagcacacagcagggatagaggttgagaatcctg

//