GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-01 11:30:47, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XM_054365659            1305 bp    mRNA    linear   PRI 26-AUG-2024
DEFINITION  PREDICTED: Homo sapiens mohawk homeobox (MKX), transcript variant
            X4, mRNA.
ACCESSION   XM_054365659
VERSION     XM_054365659.1
DBLINK      BioProject: PRJNA807723
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_060934) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_009914755.1-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/23/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1305
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /isolate="CHM13"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /sex="female"
                     /cell_line="CHM13htert"
                     /tissue_type="hydatidiform mole"
                     /note="haploid cell line"
     gene            1..1305
                     /gene="MKX"
                     /gene_synonym="C10orf48; IFRX; IRXL1"
                     /note="mohawk homeobox; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 14 ESTs, 23 long SRA
                     reads, and 100% coverage of the annotated genomic feature
                     by RNAseq alignments, including 6 samples with support for
                     all annotated introns"
                     /db_xref="GeneID:283078"
                     /db_xref="HGNC:HGNC:23729"
                     /db_xref="MIM:601332"
     CDS             196..1083
                     /gene="MKX"
                     /gene_synonym="C10orf48; IFRX; IRXL1"
                     /codon_start=1
                     /product="homeobox protein Mohawk isoform X2"
                     /protein_id="XP_054221634.1"
                     /db_xref="GeneID:283078"
                     /db_xref="HGNC:HGNC:23729"
                     /db_xref="MIM:601332"
                     /translation="
MNTIVFNKLSGAVLFEDGGASERERGGRPYSGVLDSPHARPEVGIPDGPPLKDNLGLRHRRTGARQNGGKVRHKRQALQDMARPLKQWLYKHRDNPYPTKTEKILLALGSQMTLVQVSNWFANARRRLKNTVRQPDLSWALRIKLYNKYVQGNAERLSVSSDDSCSEDGENPPRTHMNEGGYNTPVHHPVIKSENSVIKAGVRPESRASEDYVAPPKYKSSLLNRYLNDSLRHVMATNTTMMGKTRQRNHSGSFSSNEFEEELVSPSSSETEGNFVYRTVENLGSLSEDSWDFLK"
     misc_feature    order(409..423,427..429,484..486,502..504,541..543,
                     547..552,559..564,568..576,580..585)
                     /gene="MKX"
                     /gene_synonym="C10orf48; IFRX; IRXL1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(415..417,424..426,550..552,559..564,571..573)
                     /gene="MKX"
                     /gene_synonym="C10orf48; IFRX; IRXL1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    460..576
                     /gene="MKX"
                     /gene_synonym="C10orf48; IFRX; IRXL1"
                     /note="Homeobox KN domain; Region: Homeobox_KN; pfam05920"
                     /db_xref="CDD:428673"
ORIGIN      
ggtgagcgcgctggagcccgcgtggagaacatgcggcggggatgggagtgcgcctagtctcgaggcgggagagccagccgccctgcagccggccgtcggccccgcagccacagaagccgagccccgctgcggagctcccggcggcccagccccgaggctctgcggccgcgccgcgcgtccctaccaaccgacaccatgaacaccatcgtcttcaacaagctcagcggtgcggtgctgtttgaggacggaggcgcctcggagcgggagcggggtggccggccctacagcggtgtcctggacagtcctcacgcccgccccgaggtgggcattcccgacggcccgcccctcaaggacaacctcggcctgagacaccggaggaccggcgcccggcagaatggcgggaaggtgaggcacaagcggcaggccctgcaagacatggcgcgacccctcaagcagtggctttacaagcaccgtgacaacccgtaccccaccaagaccgagaagatactcttggccctcggctcgcagatgacgctagtgcaggtgtcaaattggtttgctaatgcaagacgtcggcttaagaataccgttcgacagccagatttaagctgggctttgagaataaagttatacaacaagtatgttcaaggcaatgctgaacggcttagcgtaagcagtgatgactcatgttctgaagatggagaaaatcctccaagaacccacatgaacgaagggggctataataccccagttcaccatcctgtgattaaaagtgagaattcggtcatcaaagcgggagtgaggccagagtcacgggccagtgaggactacgtggcaccccccaaatacaagagcagcttgttgaaccgttaccttaatgactctttgagacatgtcatggccacgaacactaccatgatgggaaaaacaaggcaaagaaaccactcgggatcttttagctccaatgaatttgaggaagaattagtgtctccatcgtcatcagaaactgaaggcaactttgtctatcgcacagtggaaaacttaggttctttgagtgaggactcctgggattttttaaagtaaaaacaaggagctaagaattccactccttcttgccaatatttccttcaagcaaaattattgattaatggaaaattaaatatcatatgcttcatattgcttttttacccttttgtacttgggttattttaataattttcgctagcgctacaaatgtaattgactaaaattatacatcaaaataaaacaaaaccatgggagggaaaagattatcatattttgaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]