2024-05-04 00:04:15, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_054363084 919 bp mRNA linear PRI 05-OCT-2023 DEFINITION PREDICTED: Homo sapiens paired related homeobox 2 (PRRX2), transcript variant X1, mRNA. ACCESSION XM_054363084 VERSION XM_054363084.1 DBLINK BioProject: PRJNA807723 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_060933) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_009914755.1-RS_2023_10 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Best-placed RefSeq; Gnomon; RefSeqFE; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 10/02/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..919 /organism="Homo sapiens" /mol_type="mRNA" /isolate="CHM13" /db_xref="taxon:9606" /chromosome="9" /sex="female" /cell_line="CHM13htert" /tissue_type="hydatidiform mole" /note="haploid cell line" gene 1..919 /gene="PRRX2" /gene_synonym="PMX2; PRX2" /note="paired related homeobox 2; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 35 ESTs, 16 long SRA reads, 3 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 9 samples with support for all annotated introns" /db_xref="GeneID:51450" /db_xref="HGNC:HGNC:21338" /db_xref="MIM:604675" CDS 16..597 /gene="PRRX2" /gene_synonym="PMX2; PRX2" /codon_start=1 /product="paired mesoderm homeobox protein 2 isoform X1" /protein_id="XP_054219059.1" /db_xref="GeneID:51450" /db_xref="HGNC:HGNC:21338" /db_xref="MIM:604675" /translation="
MGPLHRETGPERSGHRLKVTELGCGEGECPSPGRGSAAKRKKKQRRNRTTFNSSQLQALERVFERTHYPDAFVREELARRVNLSEARVQVWFQNRRAKFRRNERAMLASRSASLLKSYSQEAAIEQPVAPRPTALSPDYLSWTASSPYSTVPPYSPGSSGPATPGVNMANSIASLRLKAKEFSLHHSQVPTVN"
misc_feature 160..315 /gene="PRRX2" /gene_synonym="PMX2; PRX2" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(163..165,283..285,292..297,304..306) /gene="PRRX2" /gene_synonym="PMX2; PRX2" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 514..564 /gene="PRRX2" /gene_synonym="PMX2; PRX2" /note="OAR domain; Region: OAR; pfam03826" /db_xref="CDD:427530" ORIGIN
cccatctgaggccctatgggcccacttcacagggaaacaggcccagagaggagcggtcacaggctcaaagtcacagagctgggatgtggagaaggtgagtgtcccagcccggggcgcggtagcgccgccaagcggaagaagaagcagcggcggaaccgcaccacgttcaacagcagccaactgcaggcgctggagcgcgtgttcgagcgcacgcactaccccgacgcctttgtgcgcgaggagcttgcccggcgcgtcaacctcagcgaggcgcgcgttcaggtctggtttcagaaccgccgcgccaagttccgcaggaatgaaagggccatgctggccagccgctctgcctcgctgctcaagtcctacagccaggaggccgccatcgagcagcccgtggctccccggcccaccgccctgagtccagattatctctcctggacagcctcgtccccctacagcacagtgccaccctacagccctgggagctcaggccccgcaaccccaggggtcaacatggccaacagcatcgccagcctccgtctcaaggccaaggagttcagcctgcaccacagccaggtgcctacggtgaactgaagtccagtcccaccaggacccagacgcctccctgggtggacagcaatagaaaagggggcagacgcccaggaagtgaccttctcctggatgagctctcctggcccgtctgtccagcctggactcccgagcccacgaggctgttgaggcccctgcagccgggcccagctcttctgtccttggccaccagagactgcagcccacaacccttggaggggttgggccggaaggtggaagagcctgccaaggacctcatttagtttgtgtattaaaaccaaaaagcttttgtctttaagaaataaaaccatttttttaagccccaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]