ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-10-05 18:57:16, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_130459 84 bp RNA linear PRI 30-OCT-2022
DEFINITION Homo sapiens microRNA 466 (MIR466), microRNA.
ACCESSION NR_130459
VERSION NR_130459.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 84)
AUTHORS Zhao X, Zhao D, Geng B, Yaobin W and Xia Y.
TITLE A novel ceRNA regulatory network involving the long noncoding
NEAT1, miRNA-466f-3p and its mRNA target in osteoblast autophagy
and osteoporosis
JOURNAL J Mol Med (Berl) 100 (11), 1629-1646 (2022)
PUBMED 36169673
REMARK GeneRIF: A novel ceRNA regulatory network involving the long
noncoding NEAT1, miRNA-466f-3p and its mRNA target in osteoblast
autophagy and osteoporosis.
REFERENCE 2 (bases 1 to 84)
AUTHORS Wang Y, Yan B, Ni L, Si Y and Cao P.
TITLE The Clinical Significance and Functional Role of miR-466 in Gastric
Cancer Peritoneal Metastasis
JOURNAL Mol Biotechnol 64 (1), 25-32 (2022)
PUBMED 34435325
REMARK GeneRIF: The Clinical Significance and Functional Role of miR-466
in Gastric Cancer Peritoneal Metastasis.
REFERENCE 3 (bases 1 to 84)
AUTHORS Liang R, Cao X, Li Y, Chen S, Wu Y and Ma Z.
TITLE MicroRNA-466 regulates the proliferation, migration and invasion of
the human lung cancer cells by targeting transcription factor RUNX2
JOURNAL J BUON 25 (6), 2650-2656 (2020)
PUBMED 33455109
REMARK GeneRIF: MicroRNA-466 regulates the proliferation, migration and
invasion of the human lung cancer cells by targeting transcription
factor RUNX2.
REFERENCE 4 (bases 1 to 84)
AUTHORS Zhihua Z, Weiwei W, Lihua N, Jianying Z and Jiang G.
TITLE p53-induced long non-coding RNA PGM5-AS1 inhibits the progression
of esophageal squamous cell carcinoma through regulating
miR-466/PTEN axis
JOURNAL IUBMB Life 71 (10), 1492-1502 (2019)
PUBMED 31185143
REMARK GeneRIF: PGM5-AS1 was transcriptionally activated by p53 and it
could directly interact with and sequester miR-466 to elevate PTEN
expression, thereby inhibiting esophageal squamous cell carcinoma
(ESCC) progression. Overall, our data indicate that PGM5-AS1 is a
novel tumor suppressor in ESCC and restoration of PGM5-AS1 may be a
promising avenue for treatment of ESCC patient.
REFERENCE 5 (bases 1 to 84)
AUTHORS Liu M, Zhao D, Wu X, Guo S, Yan L, Zhao S, Li H, Wang Y and Rong F.
TITLE miR-466 and NUS1 Regulate the AKT/Nuclear Factor kappa B (NFkappaB)
Signaling Pathway in Intrauterine Adhesions in a Rat Model
JOURNAL Med Sci Monit 25, 4094-4103 (2019)
PUBMED 31154456
REMARK GeneRIF: NUS1 was upregulated in IUAs tissues, and the high
expression level of NUS1 was positively correlated with the
severity of IUAs. NUS1 promoted cell proliferation in vitro. NUS1
overexpression on cell migration and invasion promoted the EMT
process in vitro and in vivo.
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 84)
AUTHORS Lam WY, Cheung AC, Tung CK, Yeung AC, Ngai KL, Lui VW, Chan PK and
Tsui SK.
TITLE miR-466 is putative negative regulator of Coxsackie virus and
Adenovirus Receptor
JOURNAL FEBS Lett 589 (2), 246-254 (2015)
PUBMED 25497012
REMARK GeneRIF: Subsequent experiments also proved that both the
rno-miR-466d and the human hsa-miR-466, which are orthologs of the
miR-467 gene family, could effectively down-regulate the levels of
rat and human CAR protein expression, respectively
REFERENCE 7 (bases 1 to 84)
AUTHORS Seo M, Choi JS, Rho CR, Joo CK and Lee SK.
TITLE MicroRNA miR-466 inhibits Lymphangiogenesis by targeting
prospero-related homeobox 1 in the alkali burn corneal injury model
JOURNAL J Biomed Sci 22, 3 (2015)
PUBMED 25573115
REMARK GeneRIF: In primary lymphatic endothelial cells (HDLEC), miR-466
mimic transfection suppressed Prox1 mRNA and protein expression.
HDLEC transfected with the miR-466 mimic suppressed tube formation
as compared to the scrambled control.
Publication Status: Online-Only
REFERENCE 8 (bases 1 to 84)
AUTHORS Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L,
Loman N, Jonsson G, Naya H, Hoglund M, Borg A and Rovira C.
TITLE Identification of new microRNAs in paired normal and tumor breast
tissue suggests a dual role for the ERBB2/Her2 gene
JOURNAL Cancer Res 71 (1), 78-86 (2011)
PUBMED 21199797
REFERENCE 9 (bases 1 to 84)
AUTHORS Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC,
Parsons PG, Schmidt C, Sturm RA and Hayward NK.
TITLE Characterization of the Melanoma miRNAome by Deep Sequencing
JOURNAL PLoS One 5 (3), e9685 (2010)
PUBMED 20300190
REMARK Publication Status: Online-Only
REFERENCE 10 (bases 1 to 84)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC098647.2.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-84 AC098647.2 98499-98582 c
FEATURES Location/Qualifiers
source 1..84
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="3"
/map="3p23"
gene 1..84
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/note="microRNA 466"
/db_xref="GeneID:100423038"
/db_xref="HGNC:HGNC:38359"
/db_xref="miRBase:MI0014157"
precursor_RNA 1..84
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/product="microRNA 466"
/db_xref="GeneID:100423038"
/db_xref="HGNC:HGNC:38359"
/db_xref="miRBase:MI0014157"
exon 1..84
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/db_xref="dbSNP:1696709295"
variation 2..39
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="tgtgtgtatatgtgtgt"
/replace="tgtgtgtatatgtgtgttgcatgtgtgtatatgtgtgt"
/db_xref="dbSNP:1696708603"
variation 3
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:558470248"
variation 7
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/db_xref="dbSNP:1696709202"
variation 8..12
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="tat"
/replace="tatat"
/db_xref="dbSNP:1057006118"
variation 9
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/db_xref="dbSNP:1408990419"
variation 12
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="c"
/replace="t"
/db_xref="dbSNP:887282248"
variation 13
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="g"
/replace="t"
/db_xref="dbSNP:1217074472"
variation 20
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/db_xref="dbSNP:1696708922"
variation 21..22
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace=""
/replace="ca"
/db_xref="dbSNP:1696708897"
variation 22..43
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="atgtgtgtatat"
/replace="atgtgtgtatatgtgtgtatat"
/db_xref="dbSNP:1324246966"
variation 22
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/db_xref="dbSNP:1312327778"
variation 24
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/db_xref="dbSNP:1696708836"
variation 29..33
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="tat"
/replace="tatat"
/db_xref="dbSNP:776913999"
variation 30
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="t"
/db_xref="dbSNP:1696708806"
variation 33..39
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="tgtgt"
/replace="tgtgtgt"
/db_xref="dbSNP:1217707272"
variation 33
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="c"
/replace="t"
/db_xref="dbSNP:1212400213"
variation 34
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/db_xref="dbSNP:1268015722"
variation 36
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438386902"
variation 37
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="c"
/replace="t"
/db_xref="dbSNP:1696708667"
variation 38
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/db_xref="dbSNP:1365913525"
variation 41
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1302488061"
variation 44
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="t"
/db_xref="dbSNP:1696708450"
variation 45
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="c"
/replace="t"
/db_xref="dbSNP:1010667210"
variation 46
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/db_xref="dbSNP:904922252"
variation 47..63
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="tacacatacac"
/replace="tacacatacacatacac"
/replace="tacacatacacatacacatacac"
/db_xref="dbSNP:1436733428"
variation 51
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="c"
/replace="g"
/db_xref="dbSNP:1696708393"
ncRNA 52..74
/ncRNA_class="miRNA"
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/product="hsa-miR-466"
/db_xref="miRBase:MIMAT0015002"
/db_xref="GeneID:100423038"
/db_xref="HGNC:HGNC:38359"
/db_xref="miRBase:MI0014157"
variation 52
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/db_xref="dbSNP:540140185"
variation 57
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1055171867"
variation 58
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/db_xref="dbSNP:1044765198"
variation 59
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="c"
/replace="t"
/db_xref="dbSNP:116476604"
variation 63
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="c"
/replace="t"
/db_xref="dbSNP:1392123954"
variation 64
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/db_xref="dbSNP:548026272"
variation 67
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/db_xref="dbSNP:1460320210"
variation 68
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="c"
/replace="t"
/db_xref="dbSNP:1368640537"
variation 73
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:148367480"
variation 75
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/db_xref="dbSNP:1171472797"
variation 76
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:757485678"
variation 77
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="a"
/replace="g"
/db_xref="dbSNP:907779472"
variation 78
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="c"
/replace="t"
/db_xref="dbSNP:2470494303"
variation 82
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="c"
/replace="t"
/db_xref="dbSNP:1367788268"
variation 84
/gene="MIR466"
/gene_synonym="hsa-mir-466"
/replace="c"
/replace="t"
/db_xref="dbSNP:911739971"
ORIGIN
gtgtgtgtatatgtgtgttgcatgtgtgtatatgtgtgtatatatgtacacatacacatacacgcaacacacatatatacatgc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]