2024-05-03 10:06:23, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_039781 68 bp RNA linear PRI 11-SEP-2020 DEFINITION Homo sapiens microRNA 4638 (MIR4638), microRNA. ACCESSION NR_039781 VERSION NR_039781.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 68) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 68) AUTHORS Wang Y, Shao N, Mao X, Zhu M, Fan W, Shen Z, Xiao R, Wang C, Bao W, Xu X, Yang C, Dong J, Yu D, Wu Y, Zhu C, Wen L, Lu X, Lu YJ and Feng N. TITLE MiR-4638-5p inhibits castration resistance of prostate cancer through repressing Kidins220 expression and PI3K/AKT pathway activity JOURNAL Oncotarget 7 (30), 47444-47464 (2016) PUBMED 27329728 REMARK GeneRIF: functional role of miR-4638-5p and its downstream genes/pathways have the potential to develop biomarkers for castration resistant prostate cancer (CRPC) onset. REFERENCE 3 (bases 1 to 68) AUTHORS Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A and Rovira C. TITLE Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene JOURNAL Cancer Res. 71 (1), 78-86 (2011) PUBMED 21199797 REFERENCE 4 (bases 1 to 68) AUTHORS Kozomara A and Griffiths-Jones S. TITLE miRBase: integrating microRNA annotation and deep-sequencing data JOURNAL Nucleic Acids Res. 39 (Database issue), D152-D157 (2011) PUBMED 21037258 REFERENCE 5 (bases 1 to 68) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC008443.10. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. ##Evidence-Data-START## Transcript is intronless :: LM611366.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-68 AC008443.10 43105-43172 c FEATURES Location/Qualifiers source 1..68 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="5" /map="5q35.3" gene 1..68 /gene="MIR4638" /gene_synonym="mir-4638" /note="microRNA 4638" /db_xref="GeneID:100616342" /db_xref="HGNC:HGNC:41841" /db_xref="miRBase:MI0017265" precursor_RNA 1..68 /gene="MIR4638" /gene_synonym="mir-4638" /product="microRNA 4638" /db_xref="GeneID:100616342" /db_xref="HGNC:HGNC:41841" /db_xref="miRBase:MI0017265" exon 1..68 /gene="MIR4638" /gene_synonym="mir-4638" /inference="alignment:Splign:2.1.0" ncRNA 2..22 /ncRNA_class="miRNA" /gene="MIR4638" /gene_synonym="mir-4638" /product="hsa-miR-4638-5p" /db_xref="miRBase:MIMAT0019695" /db_xref="GeneID:100616342" /db_xref="HGNC:HGNC:41841" /db_xref="miRBase:MI0017265" variation 2 /gene="MIR4638" /gene_synonym="mir-4638" /replace="a" /replace="c" /db_xref="dbSNP:73814538" variation 3 /gene="MIR4638" /gene_synonym="mir-4638" /replace="c" /replace="g" /db_xref="dbSNP:2113131690" variation 5 /gene="MIR4638" /gene_synonym="mir-4638" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1054122661" variation 8 /gene="MIR4638" /gene_synonym="mir-4638" /replace="c" /replace="t" /db_xref="dbSNP:999139644" variation 10 /gene="MIR4638" /gene_synonym="mir-4638" /replace="a" /replace="g" /db_xref="dbSNP:1582262891" variation 11 /gene="MIR4638" /gene_synonym="mir-4638" /replace="c" /replace="t" /db_xref="dbSNP:2113131671" variation 12 /gene="MIR4638" /gene_synonym="mir-4638" /replace="a" /replace="g" /db_xref="dbSNP:1758328930" variation 14 /gene="MIR4638" /gene_synonym="mir-4638" /replace="g" /replace="t" /db_xref="dbSNP:1582262889" variation 18 /gene="MIR4638" /gene_synonym="mir-4638" /replace="c" /replace="t" /db_xref="dbSNP:146528803" variation 21 /gene="MIR4638" /gene_synonym="mir-4638" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1278650176" variation 24 /gene="MIR4638" /gene_synonym="mir-4638" /replace="c" /replace="t" /db_xref="dbSNP:1758328579" variation 25 /gene="MIR4638" /gene_synonym="mir-4638" /replace="a" /replace="g" /db_xref="dbSNP:1040753016" variation 30 /gene="MIR4638" /gene_synonym="mir-4638" /replace="c" /replace="t" /db_xref="dbSNP:1183660888" variation 32 /gene="MIR4638" /gene_synonym="mir-4638" /replace="" /replace="g" /db_xref="dbSNP:1758328140" ncRNA 35..57 /ncRNA_class="miRNA" /gene="MIR4638" /gene_synonym="mir-4638" /product="hsa-miR-4638-3p" /db_xref="miRBase:MIMAT0019696" /db_xref="GeneID:100616342" /db_xref="HGNC:HGNC:41841" /db_xref="miRBase:MI0017265" variation 35..36 /gene="MIR4638" /gene_synonym="mir-4638" /replace="c" /replace="cc" /db_xref="dbSNP:1758328074" variation 35 /gene="MIR4638" /gene_synonym="mir-4638" /replace="c" /replace="g" /db_xref="dbSNP:1211365343" variation 36 /gene="MIR4638" /gene_synonym="mir-4638" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:943819659" variation 37 /gene="MIR4638" /gene_synonym="mir-4638" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:946058190" variation 38 /gene="MIR4638" /gene_synonym="mir-4638" /replace="a" /replace="g" /db_xref="dbSNP:1758327914" variation 39 /gene="MIR4638" /gene_synonym="mir-4638" /replace="a" /replace="g" /db_xref="dbSNP:910980755" variation 41 /gene="MIR4638" /gene_synonym="mir-4638" /replace="c" /replace="t" /db_xref="dbSNP:1200248325" variation 42 /gene="MIR4638" /gene_synonym="mir-4638" /replace="a" /replace="c" /db_xref="dbSNP:1582262849" variation 45 /gene="MIR4638" /gene_synonym="mir-4638" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1182757468" variation 50 /gene="MIR4638" /gene_synonym="mir-4638" /replace="c" /replace="g" /db_xref="dbSNP:1758327473" variation 51 /gene="MIR4638" /gene_synonym="mir-4638" /replace="c" /replace="t" /db_xref="dbSNP:1049882546" variation 54 /gene="MIR4638" /gene_synonym="mir-4638" /replace="a" /replace="g" /db_xref="dbSNP:2113131563" variation 55 /gene="MIR4638" /gene_synonym="mir-4638" /replace="c" /replace="t" /db_xref="dbSNP:1180308032" variation 58 /gene="MIR4638" /gene_synonym="mir-4638" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1758327255" variation 63 /gene="MIR4638" /gene_synonym="mir-4638" /replace="g" /replace="t" /db_xref="dbSNP:1468718083" variation 67 /gene="MIR4638" /gene_synonym="mir-4638" /replace="g" /replace="t" /db_xref="dbSNP:1582262838" ORIGIN
gactcggctgcggtggacaagtccggctccagaacctggacaccgctcagccggccgcggcaggggtc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]