2024-05-02 23:39:12, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_039704 83 bp RNA linear PRI 19-APR-2022 DEFINITION Homo sapiens microRNA 4484 (MIR4484), microRNA. ACCESSION NR_039704 VERSION NR_039704.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 83) AUTHORS Zhong HY, Zhong Y, Wen Y, Tao XT, Song XB and Lu XJ. TITLE [MiR-4484 regulates the expression of integrin alpha 6 in gastric cancer tissues and its significance] JOURNAL Zhonghua Zhong Liu Za Zhi 44 (3), 246-251 (2022) PUBMED 35316874 REMARK GeneRIF: [MiR-4484 regulates the expression of integrin alpha 6 in gastric cancer tissues and its significance]. REFERENCE 2 (bases 1 to 83) AUTHORS Hu W, Xu B, Zhang J, Kou C, Liu J, Wang Q and Zhang R. TITLE Exosomal miR-146a-5p from Treponema pallidum-stimulated macrophages reduces endothelial cells permeability and monocyte transendothelial migration by targeting JAM-C JOURNAL Exp Cell Res 388 (1), 111823 (2020) PUBMED 31926946 REFERENCE 3 (bases 1 to 83) AUTHORS Rusek M, Michalska-Jakubus M, Kowal M, Beltowski J and Krasowska D. TITLE A novel miRNA-4484 is up-regulated on microarray and associated with increased MMP-21 expression in serum of systemic sclerosis patients JOURNAL Sci Rep 9 (1), 14264 (2019) PUBMED 31582779 REMARK GeneRIF: A novel miRNA-4484 is up-regulated on microarray and associated with increased MMP-21 expression in serum of systemic sclerosis patients. Publication Status: Online-Only REFERENCE 4 (bases 1 to 83) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 83) AUTHORS Nawaz Z, Patil V, Thinagararjan S, Rao SA, Hegde AS, Arivazhagan A, Santosh V and Somasundaram K. TITLE Impact of somatic copy number alterations on the glioblastoma miRNome: miR-4484 is a genomically deleted tumour suppressor JOURNAL Mol Oncol 11 (8), 927-944 (2017) PUBMED 28378523 REMARK GeneRIF: miR-4484 was found to be deleted and acts as a tumour suppressor miRNA in Glioblastoma. REFERENCE 6 (bases 1 to 83) AUTHORS Zhang K, Zhao S, Wang Q, Yang HS, Zhu J and Ma R. TITLE Identification of microRNAs in Nipple Discharge as Potential Diagnostic Biomarkers for Breast Cancer JOURNAL Ann Surg Oncol 22 Suppl 3, S536-S544 (2015) PUBMED 25976861 REMARK GeneRIF: Up-regulation of miR-4484 in nipple discharge is associated with malignant breast cancer. REFERENCE 7 (bases 1 to 83) AUTHORS Kozomara A and Griffiths-Jones S. TITLE miRBase: integrating microRNA annotation and deep-sequencing data JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011) PUBMED 21037258 REFERENCE 8 (bases 1 to 83) AUTHORS Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Liu Q, How T, Grubor V, Gao Y, Patel A, Wu H, Zhu J, Blobe GC, Lipsky PE, Chadburn A and Dave SS. CONSRTM Hematologic Malignancies Research Consortium TITLE Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs JOURNAL Blood 116 (23), e118-e127 (2010) PUBMED 20733160 REFERENCE 9 (bases 1 to 83) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AL360176.22. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. ##Evidence-Data-START## Transcript is intronless :: LM611323.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-83 AL360176.22 54410-54492 FEATURES Location/Qualifiers source 1..83 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="10" /map="10q26.2" gene 1..83 /gene="MIR4484" /gene_synonym="mir-4484" /note="microRNA 4484" /db_xref="GeneID:100616327" /db_xref="HGNC:HGNC:41799" /db_xref="miRBase:MI0016845" precursor_RNA 1..83 /gene="MIR4484" /gene_synonym="mir-4484" /product="microRNA 4484" /db_xref="GeneID:100616327" /db_xref="HGNC:HGNC:41799" /db_xref="miRBase:MI0016845" exon 1..83 /gene="MIR4484" /gene_synonym="mir-4484" /inference="alignment:Splign:2.1.0" variation 4 /gene="MIR4484" /gene_synonym="mir-4484" /replace="g" /replace="t" /db_xref="dbSNP:1590022793" variation 9 /gene="MIR4484" /gene_synonym="mir-4484" /replace="c" /replace="t" /db_xref="dbSNP:1853687742" variation 12 /gene="MIR4484" /gene_synonym="mir-4484" /replace="c" /replace="g" /db_xref="dbSNP:1243127714" variation 13 /gene="MIR4484" /gene_synonym="mir-4484" /replace="c" /replace="t" /db_xref="dbSNP:1853688258" variation 14 /gene="MIR4484" /gene_synonym="mir-4484" /replace="c" /replace="t" /db_xref="dbSNP:1853688571" variation 15..21 /gene="MIR4484" /gene_synonym="mir-4484" /replace="tttttt" /replace="ttttttt" /db_xref="dbSNP:1425937989" variation 15 /gene="MIR4484" /gene_synonym="mir-4484" /replace="c" /replace="t" /db_xref="dbSNP:1853688873" variation 20 /gene="MIR4484" /gene_synonym="mir-4484" /replace="c" /replace="t" /db_xref="dbSNP:1853689474" variation 30 /gene="MIR4484" /gene_synonym="mir-4484" /replace="a" /replace="t" /db_xref="dbSNP:1853689800" variation 31 /gene="MIR4484" /gene_synonym="mir-4484" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:531909086" variation 34 /gene="MIR4484" /gene_synonym="mir-4484" /replace="a" /replace="g" /db_xref="dbSNP:1853690446" variation 35 /gene="MIR4484" /gene_synonym="mir-4484" /replace="c" /replace="t" /db_xref="dbSNP:756708704" variation 36 /gene="MIR4484" /gene_synonym="mir-4484" /replace="a" /replace="g" /db_xref="dbSNP:1347669492" variation 40 /gene="MIR4484" /gene_synonym="mir-4484" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1256967236" variation 41 /gene="MIR4484" /gene_synonym="mir-4484" /replace="c" /replace="t" /db_xref="dbSNP:1853691574" variation 48 /gene="MIR4484" /gene_synonym="mir-4484" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:141499067" variation 50..52 /gene="MIR4484" /gene_synonym="mir-4484" /replace="cc" /replace="ccc" /db_xref="dbSNP:1853692627" variation 51 /gene="MIR4484" /gene_synonym="mir-4484" /replace="c" /replace="t" /db_xref="dbSNP:1853693098" variation 54 /gene="MIR4484" /gene_synonym="mir-4484" /replace="c" /replace="t" /db_xref="dbSNP:373233997" variation 58 /gene="MIR4484" /gene_synonym="mir-4484" /replace="a" /replace="g" /db_xref="dbSNP:1853693978" variation 61 /gene="MIR4484" /gene_synonym="mir-4484" /replace="c" /replace="g" /db_xref="dbSNP:1013026324" variation 62 /gene="MIR4484" /gene_synonym="mir-4484" /replace="g" /replace="t" /db_xref="dbSNP:968292861" variation 63..67 /gene="MIR4484" /gene_synonym="mir-4484" /replace="aaaa" /replace="aaaaa" /db_xref="dbSNP:1419248174" variation 63 /gene="MIR4484" /gene_synonym="mir-4484" /replace="a" /replace="g" /db_xref="dbSNP:1358193155" ncRNA 64..83 /ncRNA_class="miRNA" /gene="MIR4484" /gene_synonym="mir-4484" /product="hsa-miR-4484" /db_xref="miRBase:MIMAT0019018" /db_xref="GeneID:100616327" /db_xref="HGNC:HGNC:41799" /db_xref="miRBase:MI0016845" variation 68 /gene="MIR4484" /gene_synonym="mir-4484" /replace="a" /replace="g" /db_xref="dbSNP:1016421998" variation 70 /gene="MIR4484" /gene_synonym="mir-4484" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1394224088" variation 71 /gene="MIR4484" /gene_synonym="mir-4484" /replace="a" /replace="g" /db_xref="dbSNP:146182954" variation 72 /gene="MIR4484" /gene_synonym="mir-4484" /replace="a" /replace="g" /db_xref="dbSNP:1034317301" variation 75 /gene="MIR4484" /gene_synonym="mir-4484" /replace="a" /replace="g" /db_xref="dbSNP:1564807835" variation 76 /gene="MIR4484" /gene_synonym="mir-4484" /replace="a" /replace="g" /db_xref="dbSNP:959583863" variation 79..82 /gene="MIR4484" /gene_synonym="mir-4484" /replace="cccc" /replace="ccccc" /db_xref="dbSNP:993714479" ORIGIN
gggtttcctctgcctttttttccaatgaaaataacgaaacctgttatttcccattgagggggaaaaaggcgggagaagcccca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]