ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-10-05 18:57:16, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_031570 82 bp RNA linear PRI 22-JAN-2024
DEFINITION Homo sapiens microRNA 1301 (MIR1301), microRNA.
ACCESSION NR_031570
VERSION NR_031570.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 82)
AUTHORS Qu,M., Jin,Z., Xu,Y., Sun,W., Luo,Y., Zhang,N., Huang,Z., Han,L.,
Gong,Y. and Xie,C.
TITLE hsa-miR-1301-3p Promotes the Proliferation and Migration of
Nonsmall Cell Lung Cancer Cells and Reduces Radiosensitivity via
Targeting Homeodomain-Only Protein Homeobox
JOURNAL Genet Test Mol Biomarkers 27 (12), 393-405 (2023)
PUBMED 38156905
REMARK GeneRIF: hsa-miR-1301-3p Promotes the Proliferation and Migration
of Nonsmall Cell Lung Cancer Cells and Reduces Radiosensitivity via
Targeting Homeodomain-Only Protein Homeobox.
REFERENCE 2 (bases 1 to 82)
AUTHORS Guo,J., Chen,Y., Xu,J., Li,L., Dang,W., Xiao,F., Ren,W., Zhu,Y.,
Du,Q., Li,Q. and Li,X.
TITLE Long noncoding RNA PVT1 regulates the proliferation and apoptosis
of ARPE-19 cells in vitro via the miR-1301-3p/KLF7 axis
JOURNAL Cell Cycle 21 (15), 1590-1598 (2022)
PUBMED 35451342
REMARK GeneRIF: Long noncoding RNA PVT1 regulates the proliferation and
apoptosis of ARPE-19 cells in vitro via the miR-1301-3p/KLF7 axis.
REFERENCE 3 (bases 1 to 82)
AUTHORS Gong,C., Bhargava,R. and Bajaj,C.
TITLE Exploring the Study of miR-1301 Inhibiting the Proliferation and
Migration of Squamous Cell Carcinoma YD-38 Cells through PI3K/AKT
Pathway under Deep Learning Medical Images
JOURNAL Comput Intell Neurosci 2022, 5865640 (2022)
PUBMED 35186067
REMARK GeneRIF: Exploring the Study of miR-1301 Inhibiting the
Proliferation and Migration of Squamous Cell Carcinoma YD-38 Cells
through PI3K/AKT Pathway under Deep Learning Medical Images.
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 82)
AUTHORS Lu,X., Chen,L., Li,Y., Huang,R., Meng,X. and Sun,F.
TITLE Long non-coding RNA LINC01207 promotes cell proliferation and
migration but suppresses apoptosis and autophagy in oral squamous
cell carcinoma by the microRNA-1301-3p/lactate dehydrogenase
isoform A axis
JOURNAL Bioengineered 12 (1), 7780-7793 (2021)
PUBMED 34463208
REMARK GeneRIF: Long non-coding RNA LINC01207 promotes cell proliferation
and migration but suppresses apoptosis and autophagy in oral
squamous cell carcinoma by the microRNA-1301-3p/lactate
dehydrogenase isoform A axis.
REFERENCE 5 (bases 1 to 82)
AUTHORS Yang,F., Wang,H., Yan,B., Li,T., Min,L., Chen,E. and Yang,J.
TITLE Decreased level of miR-1301 promotes colorectal cancer progression
via activation of STAT3 pathway
JOURNAL Biol Chem 402 (7), 805-813 (2021)
PUBMED 33984882
REMARK GeneRIF: Decreased level of miR-1301 promotes colorectal cancer
progression via activation of STAT3 pathway.
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 82)
AUTHORS Nygaard,S., Jacobsen,A., Lindow,M., Eriksen,J., Balslev,E.,
Flyger,H., Tolstrup,N., Moller,S., Krogh,A. and Litman,T.
TITLE Identification and analysis of miRNAs in human breast cancer and
teratoma samples using deep sequencing
JOURNAL BMC Med Genomics 2, 35 (2009)
PUBMED 19508715
REMARK Publication Status: Online-Only
REFERENCE 7 (bases 1 to 82)
AUTHORS Zhu,J.Y., Pfuhl,T., Motsch,N., Barth,S., Nicholls,J., Grasser,F.
and Meister,G.
TITLE Identification of novel Epstein-Barr virus microRNA genes from
nasopharyngeal carcinomas
JOURNAL J Virol 83 (7), 3333-3341 (2009)
PUBMED 19144710
REFERENCE 8 (bases 1 to 82)
AUTHORS Morin,R.D., O'Connor,M.D., Griffith,M., Kuchenbauer,F., Delaney,A.,
Prabhu,A.L., Zhao,Y., McDonald,H., Zeng,T., Hirst,M., Eaves,C.J.
and Marra,M.A.
TITLE Application of massively parallel sequencing to microRNA profiling
and discovery in human embryonic stem cells
JOURNAL Genome Res 18 (4), 610-621 (2008)
PUBMED 18285502
REMARK Erratum:[Genome Res. 2009 May;19(5):958]
REFERENCE 9 (bases 1 to 82)
AUTHORS Berezikov,E., van Tetering,G., Verheul,M., van de Belt,J., van
Laake,L., Vos,J., Verloop,R., van de Wetering,M., Guryev,V.,
Takada,S., van Zonneveld,A.J., Mano,H., Plasterk,R. and Cuppen,E.
TITLE Many novel mammalian microRNA candidates identified by extensive
cloning and RAKE analysis
JOURNAL Genome Res 16 (10), 1289-1298 (2006)
PUBMED 16954537
REFERENCE 10 (bases 1 to 82)
AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
Enright,A.J.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC012074.9.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript is intronless :: LM609630.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-82 AC012074.9 116148-116229 c
FEATURES Location/Qualifiers
source 1..82
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="2"
/map="2p23.3"
gene 1..82
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/note="microRNA 1301"
/db_xref="GeneID:100302246"
/db_xref="HGNC:HGNC:35253"
/db_xref="miRBase:MI0003815"
precursor_RNA 1..82
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/product="microRNA 1301"
/db_xref="GeneID:100302246"
/db_xref="HGNC:HGNC:35253"
/db_xref="miRBase:MI0003815"
exon 1..82
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/db_xref="dbSNP:757593196"
variation 2
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/db_xref="dbSNP:2034889868"
variation 3
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/db_xref="dbSNP:577169496"
variation 4
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="t"
/db_xref="dbSNP:1316942870"
variation 5
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="t"
/db_xref="dbSNP:1379012905"
variation 8..13
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="ggggg"
/replace="gggggg"
/replace="ggggggg"
/db_xref="dbSNP:1401861611"
variation 8
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:555760713"
variation 12
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/db_xref="dbSNP:1376847696"
variation 13
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/db_xref="dbSNP:767557767"
variation 14
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="t"
/db_xref="dbSNP:1558745602"
ncRNA 15..33
/ncRNA_class="miRNA"
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/product="hsa-miR-1301-5p"
/db_xref="miRBase:MIMAT0026639"
/db_xref="GeneID:100302246"
/db_xref="HGNC:HGNC:35253"
/db_xref="miRBase:MI0003815"
variation 15
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="t"
/db_xref="dbSNP:759807507"
variation 16
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1424879543"
variation 19
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:774581822"
variation 23
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="g"
/replace="t"
/db_xref="dbSNP:2466072548"
variation 24
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1187681352"
variation 26
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="t"
/db_xref="dbSNP:2034888170"
variation 27
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:771147643"
variation 28
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/db_xref="dbSNP:761519349"
variation 29
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="t"
/db_xref="dbSNP:777868496"
variation 30
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="c"
/db_xref="dbSNP:2034887661"
variation 31
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:986281767"
variation 33
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/db_xref="dbSNP:2034887349"
variation 34
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="t"
/db_xref="dbSNP:776429721"
variation 35
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="t"
/db_xref="dbSNP:1344448470"
variation 36
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:768534747"
variation 37
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="g"
/replace="t"
/db_xref="dbSNP:953190057"
variation 39
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="t"
/db_xref="dbSNP:1311448598"
variation 41
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="g"
/replace="t"
/db_xref="dbSNP:537711718"
variation 42
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/db_xref="dbSNP:1216265551"
variation 43
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/db_xref="dbSNP:1359711868"
variation 44
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="g"
/replace="t"
/db_xref="dbSNP:1277046868"
variation 46
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="t"
/db_xref="dbSNP:2466072363"
ncRNA 48..71
/ncRNA_class="miRNA"
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/product="hsa-miR-1301-3p"
/db_xref="miRBase:MIMAT0005797"
/db_xref="GeneID:100302246"
/db_xref="HGNC:HGNC:35253"
/db_xref="miRBase:MI0003815"
variation 48..49
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="t"
/replace="tt"
/db_xref="dbSNP:2034886071"
variation 51
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="t"
/db_xref="dbSNP:2034885949"
variation 53
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="g"
/db_xref="dbSNP:775188648"
variation 56
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/db_xref="dbSNP:2466072316"
variation 57..59
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace=""
/replace="cct"
/db_xref="dbSNP:2466072298"
variation 58
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="t"
/db_xref="dbSNP:1022364375"
variation 59
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="t"
/db_xref="dbSNP:938368115"
variation 61
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/db_xref="dbSNP:2034885397"
variation 62
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:771728471"
variation 64
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace=""
/replace="g"
/db_xref="dbSNP:2466072249"
variation 66
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:778709428"
variation 67
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1358947891"
variation 69
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="t"
/db_xref="dbSNP:2034884772"
variation 73
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="g"
/db_xref="dbSNP:1171493034"
variation 74
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/db_xref="dbSNP:2034884523"
variation 75
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="g"
/db_xref="dbSNP:2466072186"
variation 76
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="a"
/replace="g"
/db_xref="dbSNP:756873374"
variation 78
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="t"
/db_xref="dbSNP:749668326"
variation 79
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="t"
/db_xref="dbSNP:1193536121"
variation 82
/gene="MIR1301"
/gene_synonym="hsa-mir-1301; mir-1301; MIRN1301"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:778191737"
ORIGIN
ggattgtggggggtcgctctaggcaccgcagcactgtgctggggatgttgcagctgcctgggagtgacttcacacagtcctc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]