2024-05-03 10:14:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_030358 95 bp RNA linear PRI 02-JAN-2023 DEFINITION Homo sapiens microRNA 628 (MIR628), microRNA. ACCESSION NR_030358 VERSION NR_030358.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 95) AUTHORS Wang L, Yi X, Xiao X, Zheng Q, Ma L and Li B. TITLE Exosomal miR-628-5p from M1 polarized macrophages hinders m6A modification of circFUT8 to suppress hepatocellular carcinoma progression JOURNAL Cell Mol Biol Lett 27 (1), 106 (2022) PUBMED 36474147 REMARK GeneRIF: Exosomal miR-628-5p from M1 polarized macrophages hinders m6A modification of circFUT8 to suppress hepatocellular carcinoma progression. Publication Status: Online-Only REFERENCE 2 (bases 1 to 95) AUTHORS Zhang J, Wang F, Zhang H and Cao M. TITLE A novel circular RNA circ_HN1/miR-628-5p/Ecto-5'-nucleotidase competing endogenous RNA network regulates gastric cancer development JOURNAL Bioengineered 12 (2), 9739-9752 (2021) PUBMED 34637682 REMARK GeneRIF: A novel circular RNA circ_HN1/miR-628-5p/Ecto-5'-nucleotidase competing endogenous RNA network regulates gastric cancer development. REFERENCE 3 (bases 1 to 95) AUTHORS Ueta M, Nishigaki H, Komai S, Sotozono C and Kinoshita S. TITLE Difference in the plasma level of miR-628-3p in atopic dermatitis patients with/without atopic keratoconjunctivitis JOURNAL Immun Inflamm Dis 9 (4), 1815-1819 (2021) PUBMED 34547828 REMARK GeneRIF: Difference in the plasma level of miR-628-3p in atopic dermatitis patients with/without atopic keratoconjunctivitis. REFERENCE 4 (bases 1 to 95) AUTHORS Zhao X, Liu Y, Luo C and Zuo Y. TITLE AGAP2-AS1/miR-628-5p/FOXP2 feedback loop facilitates the growth of prostate cancer via activating WNT pathway JOURNAL Carcinogenesis 42 (10), 1270-1280 (2021) PUBMED 34255057 REMARK GeneRIF: AGAP2-AS1/miR-628-5p/FOXP2 feedback loop facilitates the growth of prostate cancer via activating WNT pathway. Erratum:[Carcinogenesis. 2022 Feb 11;43(1):77. PMID: 35078236] REFERENCE 5 (bases 1 to 95) AUTHORS Ueta M, Nishigaki H, Mizushima K, Naito Y, Sotozono C and Kinoshita S. TITLE Regulation of innate immune response by miR-628-3p upregulated in the plasma of Stevens-Johnson syndrome patients JOURNAL Ocul Surf 21, 174-177 (2021) PUBMED 34058393 REMARK GeneRIF: Regulation of innate immune response by miR-628-3p upregulated in the plasma of Stevens-Johnson syndrome patients. REFERENCE 6 (bases 1 to 95) AUTHORS Tambyah PA, Sepramaniam S, Mohamed Ali J, Chai SC, Swaminathan P, Armugam A and Jeyaseelan K. TITLE microRNAs in circulation are altered in response to influenza A virus infection in humans JOURNAL PLoS One 8 (10), e76811 (2013) PUBMED 24116168 REMARK GeneRIF: Data indicate that expression of miR-1260, -26a, -335*, -576-3p, -628-3p and -664 were consistently dysregulated in both whole blood and H1N1 infected cells. Publication Status: Online-Only REFERENCE 7 (bases 1 to 95) AUTHORS Kozomara A and Griffiths-Jones S. TITLE miRBase: integrating microRNA annotation and deep-sequencing data JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011) PUBMED 21037258 REFERENCE 8 (bases 1 to 95) AUTHORS Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M and Tuschl T. TITLE A mammalian microRNA expression atlas based on small RNA library sequencing JOURNAL Cell 129 (7), 1401-1414 (2007) PUBMED 17604727 REFERENCE 9 (bases 1 to 95) AUTHORS Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B and Velculescu VE. TITLE The colorectal microRNAome JOURNAL Proc Natl Acad Sci U S A 103 (10), 3687-3692 (2006) PUBMED 16505370 REFERENCE 10 (bases 1 to 95) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC018926.10. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript is intronless :: LM609581.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-95 AC018926.10 144986-145080 c FEATURES Location/Qualifiers source 1..95 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="15" /map="15q21.3" gene 1..95 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /note="microRNA 628" /db_xref="GeneID:693213" /db_xref="HGNC:HGNC:32884" /db_xref="miRBase:MI0003642" precursor_RNA 1..95 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /product="microRNA 628" /db_xref="GeneID:693213" /db_xref="HGNC:HGNC:32884" /db_xref="miRBase:MI0003642" exon 1..95 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /inference="alignment:Splign:2.1.0" variation 1 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="g" /db_xref="dbSNP:2056486796" variation 7 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="g" /db_xref="dbSNP:991172211" variation 8 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="c" /replace="t" /db_xref="dbSNP:1473905485" variation 10 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="g" /db_xref="dbSNP:767654407" variation 11 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="g" /replace="t" /db_xref="dbSNP:759658993" variation 13 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="g" /replace="t" /db_xref="dbSNP:2056486457" variation 14 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="c" /replace="g" /db_xref="dbSNP:751898346" variation 16 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="c" /db_xref="dbSNP:959750310" variation 19 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="c" /replace="t" /db_xref="dbSNP:766694965" variation 20 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:2056486166" ncRNA 23..44 /ncRNA_class="miRNA" /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /product="hsa-miR-628-5p" /db_xref="miRBase:MIMAT0004809" /db_xref="GeneID:693213" /db_xref="HGNC:HGNC:32884" /db_xref="miRBase:MI0003642" variation 25 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="c" /replace="g" /db_xref="dbSNP:2056486108" variation 30 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:761527552" variation 31..34 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="at" /replace="atat" /db_xref="dbSNP:747172385" variation 31 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="g" /db_xref="dbSNP:776423775" variation 33 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="g" /db_xref="dbSNP:200771662" variation 34 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="c" /replace="t" /db_xref="dbSNP:760615166" variation 38 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="c" /replace="t" /db_xref="dbSNP:775387693" variation 40 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="c" /db_xref="dbSNP:2141272190" variation 41 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:771606673" variation 43 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="c" /replace="g" /db_xref="dbSNP:745373506" variation 45 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="g" /db_xref="dbSNP:774044971" variation 46 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="c" /replace="t" /db_xref="dbSNP:2056485388" variation 47..50 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="aaa" /replace="aaaa" /replace="aaaaaaa" /db_xref="dbSNP:1330238259" variation 47 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="g" /db_xref="dbSNP:770558916" variation 52 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="g" /replace="t" /db_xref="dbSNP:990019453" variation 53 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="g" /db_xref="dbSNP:1323991861" variation 54 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="g" /db_xref="dbSNP:1407253165" variation 55 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="t" /db_xref="dbSNP:1358908717" variation 59..63 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="ct" /replace="cttct" /db_xref="dbSNP:1322836365" variation 59 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="c" /replace="t" /db_xref="dbSNP:1157138998" ncRNA 61..81 /ncRNA_class="miRNA" /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /product="hsa-miR-628-3p" /db_xref="miRBase:MIMAT0003297" /db_xref="GeneID:693213" /db_xref="HGNC:HGNC:32884" /db_xref="miRBase:MI0003642" variation 62 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="c" /replace="g" /db_xref="dbSNP:1410255602" variation 63 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="c" /replace="t" /db_xref="dbSNP:1401315366" variation 68 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1158103480" variation 71 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="g" /db_xref="dbSNP:1216611749" variation 73 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="g" /db_xref="dbSNP:749619551" variation 78..82 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="" /replace="tcgaa" /db_xref="dbSNP:148138194" variation 78 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:778157225" variation 79 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="c" /replace="t" /db_xref="dbSNP:756600789" variation 80 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="g" /db_xref="dbSNP:2056484329" variation 81 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="g" /db_xref="dbSNP:1595835339" variation 86 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="g" /db_xref="dbSNP:1595835326" variation 91 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="c" /replace="g" /db_xref="dbSNP:1595835322" variation 93 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="c" /replace="t" /db_xref="dbSNP:2056484038" variation 94 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:539846581" variation 95 /gene="MIR628" /gene_synonym="hsa-mir-628; mir-628; MIRN628" /replace="a" /replace="t" /db_xref="dbSNP:1247609413" ORIGIN
atagctgttgtgtcacttcctcatgctgacatatttactagagggtaaaattaataaccttctagtaagagtggcagtcgaagggaagggctcat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]