2024-05-03 06:42:57, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_030232 127 bp RNA linear PRI 25-SEP-2022 DEFINITION Homo sapiens microRNA 513a-2 (MIR513A2), microRNA. ACCESSION NR_030232 VERSION NR_030232.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 127) AUTHORS Li X, Zhang Y, Wang N, Yuan Z, Chen X, Chen Q, Deng H, Tong X, Chen H, Duan Y and Wei Y. TITLE CircRNA.0007127 triggers apoptosis through the miR-513a-5p/CASP8 axis in K-562 cells JOURNAL J Zhejiang Univ Sci B 23 (9), 732-746 (2022) PUBMED 36111570 REMARK GeneRIF: CircRNA.0007127 triggers apoptosis through the miR-513a-5p/CASP8 axis in K-562 cells. REFERENCE 2 (bases 1 to 127) AUTHORS Wang Y, Cao B, Zhao R, Li H, Wei B and Dai G. TITLE Knockdown of circBFAR inhibits proliferation and glycolysis in gastric cancer by sponging miR-513a-3p/hexokinase 2 axis JOURNAL Biochem Biophys Res Commun 560, 80-86 (2021) PUBMED 33979737 REMARK GeneRIF: Knockdown of circBFAR inhibits proliferation and glycolysis in gastric cancer by sponging miR-513a-3p/hexokinase 2 axis. REFERENCE 3 (bases 1 to 127) AUTHORS Zhao JL, Zhao LL, Niu WZ, Ding XC and Zhang WL. TITLE [Deleted in lymphocytic leukemia 1 promoted proliferation and apoptosis of nephroblastoma cells through regulating miR-513a-5p and RANBP2 pathway] JOURNAL Zhonghua Zhong Liu Za Zhi 42 (10), 849-855 (2020) PUBMED 33113626 REMARK GeneRIF: [Deleted in lymphocytic leukemia 1 promoted proliferation and apoptosis of nephroblastoma cells through regulating miR-513a-5p and RANBP2 pathway]. REFERENCE 4 (bases 1 to 127) AUTHORS Li J, Huang C, Zou Y, Yu J and Gui Y. TITLE Circular RNA MYLK promotes tumour growth and metastasis via modulating miR-513a-5p/VEGFC signalling in renal cell carcinoma JOURNAL J Cell Mol Med 24 (12), 6609-6621 (2020) PUBMED 32342645 REMARK GeneRIF: Circular RNA MYLK promotes tumour growth and metastasis via modulating miR-513a-5p/VEGFC signalling in renal cell carcinoma. REFERENCE 5 (bases 1 to 127) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 127) AUTHORS Troppmann B, Kossack N, Nordhoff V, Schuring AN and Gromoll J. TITLE MicroRNA miR-513a-3p acts as a co-regulator of luteinizing hormone/chorionic gonadotropin receptor gene expression in human granulosa cells JOURNAL Mol Cell Endocrinol 390 (1-2), 65-72 (2014) PUBMED 24747085 REMARK GeneRIF: miR-513a-3p is involved in the control of the LHCGR expression by an inversely regulated mechanism at the post-transcriptional level. REFERENCE 7 (bases 1 to 127) AUTHORS Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M and Tuschl T. TITLE A mammalian microRNA expression atlas based on small RNA library sequencing JOURNAL Cell 129 (7), 1401-1414 (2007) PUBMED 17604727 REFERENCE 8 (bases 1 to 127) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 REFERENCE 9 (bases 1 to 127) AUTHORS Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y and Bentwich Z. TITLE Identification of hundreds of conserved and nonconserved human microRNAs JOURNAL Nat Genet 37 (7), 766-770 (2005) PUBMED 15965474 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AL589669.11. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-127 AL589669.11 114287-114413 c FEATURES Location/Qualifiers source 1..127 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="X" /map="Xq27.3" gene 1..127 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /note="microRNA 513a-2" /db_xref="GeneID:574510" /db_xref="HGNC:HGNC:32142" /db_xref="miRBase:MI0003192" precursor_RNA 1..127 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /product="microRNA 513a-2" /db_xref="GeneID:574510" /db_xref="HGNC:HGNC:32142" /db_xref="miRBase:MI0003192" exon 1..127 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /inference="alignment:Splign:2.1.0" variation 1 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:1557100192" variation 2 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:782327209" variation 3 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="t" /db_xref="dbSNP:1557100191" variation 7 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="t" /db_xref="dbSNP:2015989817" variation 8 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:377537170" variation 9..23 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="cattcag" /replace="cattcagccattcag" /db_xref="dbSNP:782578425" variation 10 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="t" /db_xref="dbSNP:2015989679" variation 11 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="t" /db_xref="dbSNP:1557100190" variation 13 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:782028037" variation 14 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:782396876" variation 17..29 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="cattcagtgtgca" /replace="cattcagtgtgcattcagtgtgca" /db_xref="dbSNP:782307168" variation 20 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="t" /db_xref="dbSNP:373052953" variation 21..32 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="cagtg" /replace="cagtgtgcagtg" /db_xref="dbSNP:1557100175" variation 22 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:111970838" variation 24 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:925239760" variation 25 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:782614546" variation 26 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="t" /db_xref="dbSNP:1557100180" variation 27 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:979447762" variation 28..34 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="cagtgcc" /db_xref="dbSNP:782294397" variation 28 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:782487623" variation 30 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:1569536653" variation 33..36 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="cctt" /replace="ccttcctt" /db_xref="dbSNP:782669807" variation 34 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="t" /db_xref="dbSNP:782204335" variation 35 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="t" /db_xref="dbSNP:1362846785" ncRNA 36..53 /ncRNA_class="miRNA" /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /product="hsa-miR-513a-5p" /db_xref="miRBase:MIMAT0002877" /db_xref="GeneID:574510" /db_xref="HGNC:HGNC:32142" /db_xref="miRBase:MI0003192" variation 38 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="c" /db_xref="dbSNP:1557100170" variation 43 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:782577003" variation 46 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:782552773" variation 48 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="t" /db_xref="dbSNP:1557100166" variation 50 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="t" /db_xref="dbSNP:369895206" variation 51 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="g" /db_xref="dbSNP:782795793" variation 53 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="g" /replace="t" /db_xref="dbSNP:2015988062" variation 57 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="t" /db_xref="dbSNP:193181398" variation 58 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="g" /replace="t" /db_xref="dbSNP:2124342773" variation 60 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:372214863" variation 63 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="t" /db_xref="dbSNP:1557100160" variation 65 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:368775756" variation 67..70 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="aata" /replace="aataata" /db_xref="dbSNP:2015987694" ncRNA 71..93 /ncRNA_class="miRNA" /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /product="hsa-miR-513a-3p" /db_xref="miRBase:MIMAT0004777" /db_xref="GeneID:574510" /db_xref="HGNC:HGNC:32142" /db_xref="miRBase:MI0003192" variation 71 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="g" /replace="t" /db_xref="dbSNP:1376206275" variation 76 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="g" /replace="t" /db_xref="dbSNP:1240793492" variation 81 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="t" /db_xref="dbSNP:1557100149" variation 85 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="g" /db_xref="dbSNP:782066339" variation 93 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1557100144" variation 94..101 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="gtaatgta" /replace="gtaatgtaatgta" /db_xref="dbSNP:2015987041" variation 94 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="g" /db_xref="dbSNP:2015987321" variation 96 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:376408446" variation 97 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:1557100142" variation 99 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:2015987108" variation 103 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="c" /db_xref="dbSNP:965184900" variation 104 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:782806082" variation 105 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="c" /db_xref="dbSNP:782143012" variation 107 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="g" /replace="t" /db_xref="dbSNP:1557100137" variation 108 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:781994871" variation 109 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="c" /db_xref="dbSNP:1603229462" variation 111 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="g" /db_xref="dbSNP:2015986584" variation 114 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="t" /db_xref="dbSNP:2015986510" variation 115 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:1319767773" variation 117 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="a" /replace="g" /db_xref="dbSNP:2015986371" variation 119 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="c" /replace="g" /db_xref="dbSNP:782374243" variation 123 /gene="MIR513A2" /gene_synonym="hsa-mir-513a-2; MIRN513-2; MIRN513A-2; MIRN513A2" /replace="g" /replace="t" /db_xref="dbSNP:2124342645" ORIGIN
ggatgccacattcagccattcagtgtgcagtgcctttcacagggaggtgtcatttatgtgaactaaaatataaatttcacctttctgagaagggtaatgtacagcatgcactgcatatgtggtgtcc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]