2024-05-04 08:56:17, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_012149 594 bp mRNA linear PRI 21-DEC-2022 DEFINITION Homo sapiens double homeobox 5 (DUX5), mRNA. ACCESSION NM_012149 VERSION NM_012149.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 594) AUTHORS Ostlund C, Garcia-Carrasquillo RM, Belayew A and Worman HJ. TITLE Intracellular trafficking and dynamics of double homeodomain proteins JOURNAL Biochemistry 44 (7), 2378-2384 (2005) PUBMED 15709750 REFERENCE 2 (bases 1 to 594) AUTHORS Beckers M, Gabriels J, van der Maarel S, De Vriese A, Frants RR, Collen D and Belayew A. TITLE Active genes in junk DNA? Characterization of DUX genes embedded within 3.3 kb repeated elements JOURNAL Gene 264 (1), 51-57 (2001) PUBMED 11245978 REFERENCE 3 (bases 1 to 594) AUTHORS Ding H, Beckers MC, Plaisance S, Marynen P, Collen D and Belayew A. TITLE Characterization of a double homeodomain protein (DUX1) encoded by a cDNA homologous to 3.3 kb dispersed repeated elements JOURNAL Hum Mol Genet 7 (11), 1681-1694 (1998) PUBMED 9736770 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AF133131.1. On May 13, 2005 this sequence version replaced NM_012149.1. Summary: The human genome contains hundreds of repeats of the 3.3-kb family in regions associated with heterochromatin. The DUX gene family, including DUX5, resides within these 3.3-kb repeated elements (Beckers et al., 2001 [PubMed 11245978]). See DUX4 (MIM 606009).[supplied by OMIM, Mar 2008]. Sequence Note: The 5'-most translation start codon is selected for this RefSeq. The use of an alternative downstream start codon would result in a protein that is 27 aa shorter at the N-terminus. In vitro translation studies in PMID:11245978 indicate that both the longer and shorter proteins can be produced from this transcript. ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-594 AF133131.1 266-859 FEATURES Location/Qualifiers source 1..594 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="14" /map="14" gene 1..594 /gene="DUX5" /gene_synonym="DUX1" /note="double homeobox 5" /db_xref="GeneID:26581" /db_xref="HGNC:HGNC:3083" /db_xref="MIM:611444" CDS 1..594 /gene="DUX5" /gene_synonym="DUX1" /note="double homeobox protein; alternative translation start site; double homeobox protein 1; epididymis secretory sperm binding protein" /codon_start=1 /product="double homeobox protein 5" /protein_id="NP_036281.2" /db_xref="GeneID:26581" /db_xref="HGNC:HGNC:3083" /db_xref="MIM:611444" /translation="
MPAEVHGSPPASLCPCQSVKFRPGLPEMALLTALDDTLPEEAQGPGRRMILLSTPSQSDALRACFERNLYPGIATKEELAQGIDIPEPRVQIWFQNERSCQLRQHRRQSRPWPGRRDPQKGRRKRTAITGSQTALLLRAFEKDRFPGIAAREELARETGLPESRIQIWFQNRRARHRGQSGRAPTQASIRCNAAPIG"
misc_feature 160..297 /gene="DUX5" /gene_synonym="DUX1" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cl00084" /db_xref="CDD:444687" misc_feature 301..381 /gene="DUX5" /gene_synonym="DUX1" /note="propagated from UniProtKB/Swiss-Prot (Q96PT3.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature order(364..378,382..384,433..435,451..453,490..492, 496..501,508..513,517..525,529..534) /gene="DUX5" /gene_synonym="DUX1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 370..531 /gene="DUX5" /gene_synonym="DUX1" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(370..372,379..381,499..501,508..513,520..522) /gene="DUX5" /gene_synonym="DUX1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" exon 1..594 /gene="DUX5" /gene_synonym="DUX1" /inference="alignment:Splign:2.1.0" ORIGIN
atgccggctgaggtgcacgggagcccgcccgcctctctctgcccgtgtcagtccgtgaaattccggccggggctccctgagatggccctcctgacagctttggacgacaccctccccgaggaagcccagggaccgggaaggcgaatgatactcctttcgaccccgagtcaaagtgatgccctgcgagcctgctttgagcggaacctgtacccgggcattgccaccaaagaagagctggcccagggcatcgacattccggagcccagggtccagatttggtttcagaatgagagatcatgccagttgaggcagcaccggcggcaatctcggccctggcccgggagacgtgacccgcaaaaaggcagacgaaagcggactgccatcaccggatcccaaaccgccctgctcctccgagcctttgagaaggatcgctttccaggcattgctgccagggaagagctggccagagagacgggcctcccggagtccaggattcagatctggtttcagaatcgaagagccaggcaccggggacagtctggcagggcgcccacgcaggcaagcatccggtgcaatgcagccccaattgggtga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]