GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-10-14 05:27:23, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NM_001438732            3362 bp    mRNA    linear   PRI 23-APR-2025
DEFINITION  Homo sapiens intestine specific homeobox (ISX), transcript variant
            2, mRNA.
ACCESSION   NM_001438732 XM_047441598 XM_054326131
VERSION     NM_001438732.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3362)
  AUTHORS   Bui,A.Q., Gunathilake,M., Lee,J., Oh,J.H., Chang,H.J., Sohn,D.K.,
            Shin,A. and Kim,J.
  TITLE     Interaction between retinol intake and ISX rs5755368 polymorphism
            in colorectal cancer risk: a case-control study in a Korean
            population
  JOURNAL   Sci Rep 13 (1), 10187 (2023)
   PUBMED   37349365
  REMARK    GeneRIF: Interaction between retinol intake and ISX rs5755368
            polymorphism in colorectal cancer risk: a case-control study in a
            Korean population.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 3362)
  AUTHORS   Wang,L.T., Liu,K.Y., Chiou,S.S., Huang,S.K., Hsu,S.H. and Wang,S.N.
  TITLE     Phosphorylation of intestine-specific homeobox by ERK1 modulates
            oncogenic activity and sorafenib resistance
  JOURNAL   Cancer Lett 520, 160-171 (2021)
   PUBMED   34265398
  REMARK    GeneRIF: Phosphorylation of intestine-specific homeobox by ERK1
            modulates oncogenic activity and sorafenib resistance.
REFERENCE   3  (bases 1 to 3362)
  AUTHORS   Chuang,K.T., Wang,S.N., Hsu,S.H. and Wang,L.T.
  TITLE     Impact of bromodomain-containing protein 4 (BRD4) and
            intestine-specific homeobox (ISX) expression on the prognosis of
            patients with hepatocellular carcinoma' for better clarity
  JOURNAL   Cancer Med 10 (16), 5545-5556 (2021)
   PUBMED   34173348
  REMARK    GeneRIF: Impact of bromodomain-containing protein 4 (BRD4) and
            intestine-specific homeobox (ISX) expression on the prognosis of
            patients with hepatocellular carcinoma' for better clarity.
REFERENCE   4  (bases 1 to 3362)
  AUTHORS   Luck,K., Kim,D.K., Lambourne,L., Spirohn,K., Begg,B.E., Bian,W.,
            Brignall,R., Cafarelli,T., Campos-Laborie,F.J., Charloteaux,B.,
            Choi,D., Cote,A.G., Daley,M., Deimling,S., Desbuleux,A., Dricot,A.,
            Gebbia,M., Hardy,M.F., Kishore,N., Knapp,J.J., Kovacs,I.A.,
            Lemmens,I., Mee,M.W., Mellor,J.C., Pollis,C., Pons,C.,
            Richardson,A.D., Schlabach,S., Teeking,B., Yadav,A., Babor,M.,
            Balcha,D., Basha,O., Bowman-Colin,C., Chin,S.F., Choi,S.G.,
            Colabella,C., Coppin,G., D'Amata,C., De Ridder,D., De Rouck,S.,
            Duran-Frigola,M., Ennajdaoui,H., Goebels,F., Goehring,L., Gopal,A.,
            Haddad,G., Hatchi,E., Helmy,M., Jacob,Y., Kassa,Y., Landini,S.,
            Li,R., van Lieshout,N., MacWilliams,A., Markey,D., Paulson,J.N.,
            Rangarajan,S., Rasla,J., Rayhan,A., Rolland,T., San-Miguel,A.,
            Shen,Y., Sheykhkarimli,D., Sheynkman,G.M., Simonovsky,E., Tasan,M.,
            Tejeda,A., Tropepe,V., Twizere,J.C., Wang,Y., Weatheritt,R.J.,
            Weile,J., Xia,Y., Yang,X., Yeger-Lotem,E., Zhong,Q., Aloy,P.,
            Bader,G.D., De Las Rivas,J., Gaudet,S., Hao,T., Rak,J.,
            Tavernier,J., Hill,D.E., Vidal,M., Roth,F.P. and Calderwood,M.A.
  TITLE     A reference map of the human binary protein interactome
  JOURNAL   Nature 580 (7803), 402-408 (2020)
   PUBMED   32296183
REFERENCE   5  (bases 1 to 3362)
  AUTHORS   Wang,L.T., Chiou,S.S., Chai,C.Y., Hsi,E., Yokoyama,K.K., Wang,S.N.,
            Huang,S.K. and Hsu,S.H.
  TITLE     Intestine-Specific Homeobox Gene ISX Integrates IL6 Signaling,
            Tryptophan Catabolism, and Immune Suppression
  JOURNAL   Cancer Res 77 (15), 4065-4077 (2017)
   PUBMED   28625979
  REMARK    GeneRIF: Overall, our results identified a feed-forward mechanism
            of immune suppression in hepatocellular carcinoma organized by ISX,
            which involves kynurenine-AHR signaling and PD-L1, offering
            insights into immune escape by hepatocellular carcinoma
REFERENCE   6  (bases 1 to 3362)
  AUTHORS   Sue,S., Shibata,W., Kameta,E., Sato,T., Ishii,Y., Kaneko,H.,
            Miwa,H., Sasaki,T., Tamura,T., Kondo,M. and Maeda,S.
  TITLE     Intestine-specific homeobox (ISX) induces intestinal metaplasia and
            cell proliferation to contribute to gastric carcinogenesis
  JOURNAL   J Gastroenterol 51 (10), 949-960 (2016)
   PUBMED   26872890
  REMARK    GeneRIF: ISX expression induced by H. pylori infection may lead to
            intestinal metaplasia and hyperproliferation of gastric mucosa
            through CDX1/2 and cyclinD1 expression, contributing to gastric
            carcinogenesis.
REFERENCE   7  (bases 1 to 3362)
  AUTHORS   Lobo,G.P., Amengual,J., Baus,D., Shivdasani,R.A., Taylor,D. and von
            Lintig,J.
  TITLE     Genetics and diet regulate vitamin A production via the homeobox
            transcription factor ISX
  JOURNAL   J Biol Chem 288 (13), 9017-9027 (2013)
   PUBMED   23393141
  REMARK    GeneRIF: Genetics and diet regulate vitamin A production via the
            homeobox transcription factor ISX
REFERENCE   8  (bases 1 to 3362)
  AUTHORS   Hsu,S.H., Wang,L.T., Lee,K.T., Chen,Y.L., Liu,K.Y., Suen,J.L.,
            Chai,C.Y. and Wang,S.N.
  TITLE     Proinflammatory homeobox gene, ISX, regulates tumor growth and
            survival in hepatocellular carcinoma
  JOURNAL   Cancer Res 73 (2), 508-518 (2013)
   PUBMED   23221382
  REMARK    GeneRIF: our results highlight ISX as an important regulator in
            hepatoma progression with significant potential as a prognostic and
            therapeutic target in HCCs.
REFERENCE   9  (bases 1 to 3362)
  AUTHORS   Vaquerizas,J.M., Kummerfeld,S.K., Teichmann,S.A. and Luscombe,N.M.
  TITLE     A census of human transcription factors: function, expression and
            evolution
  JOURNAL   Nat Rev Genet 10 (4), 252-263 (2009)
   PUBMED   19274049
  REMARK    Review article
REFERENCE   10 (bases 1 to 3362)
  AUTHORS   Seino,Y., Miki,T., Kiyonari,H., Abe,T., Fujimoto,W., Kimura,K.,
            Takeuchi,A., Takahashi,Y., Oiso,Y., Iwanaga,T. and Seino,S.
  TITLE     Isx participates in the maintenance of vitamin A metabolism by
            regulation of beta-carotene 15,15'-monooxygenase (Bcmo1) expression
  JOURNAL   J Biol Chem 283 (8), 4905-4911 (2008)
   PUBMED   18093975
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            Z83853.2 and AL024494.1.
            
            On or before Apr 23, 2025 this sequence version replaced
            XM_047441598.1, XM_054326131.1.
            
            Summary: Homeobox genes encode DNA-binding proteins, many of which
            are thought to be involved in early embryonic development. Homeobox
            genes encode a DNA-binding domain of 60 to 63 amino acids referred
            to as the homeodomain. This gene is a member of the RAXLX homeobox
            gene family. [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR14038196.3099211.1,
                                           SRR11853560.19571.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968540, SAMEA2142348
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1159              Z83853.2           5513-6671           c
            1160-1311           AL024494.1         9790-9941
            1312-1428           AL024494.1         11655-11771
            1429-3362           AL024494.1         12726-14659
FEATURES             Location/Qualifiers
     source          1..3362
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="22"
                     /map="22q12.3"
     gene            1..3362
                     /gene="ISX"
                     /gene_synonym="Pix-1; RAXLX"
                     /note="intestine specific homeobox"
                     /db_xref="GeneID:91464"
                     /db_xref="HGNC:HGNC:28084"
                     /db_xref="MIM:612019"
     exon            1..1159
                     /gene="ISX"
                     /gene_synonym="Pix-1; RAXLX"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    805..807
                     /gene="ISX"
                     /gene_synonym="Pix-1; RAXLX"
                     /note="upstream in-frame stop codon"
     CDS             931..1668
                     /gene="ISX"
                     /gene_synonym="Pix-1; RAXLX"
                     /note="pancreas-intestine homeodomain transcription
                     factor; RAX-like homeobox"
                     /codon_start=1
                     /product="intestine-specific homeobox"
                     /protein_id="NP_001425661.1"
                     /db_xref="GeneID:91464"
                     /db_xref="HGNC:HGNC:28084"
                     /db_xref="MIM:612019"
                     /translation="
MCAEVGPALCRGMERNSLGCCEAPKKLSLSFSIEAILKRPARRSDMDRPEGPGEEGPGEAAASGSGLEKPPKDQPQEGRKSKRRVRTTFTTEQLHELEKIFHFTHYPDVHIRSQLAARINLPEARVQIWFQNQRAKWRKQEKIGNLGAPQQLSEASVALPTNLDVAGPTWTSTALRRLAPPTSCCPSAQDQLASAWFPAWITLLPAHPWETQPVPGLPIHQTCIPVLCILPPPHPKWGSICATST"
     misc_feature    1042..1188
                     /gene="ISX"
                     /gene_synonym="Pix-1; RAXLX"
                     /note="propagated from UniProtKB/Swiss-Prot (Q2M1V0.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            1160..1311
                     /gene="ISX"
                     /gene_synonym="Pix-1; RAXLX"
                     /inference="alignment:Splign:2.1.0"
     exon            1312..1428
                     /gene="ISX"
                     /gene_synonym="Pix-1; RAXLX"
                     /inference="alignment:Splign:2.1.0"
     exon            1429..3362
                     /gene="ISX"
                     /gene_synonym="Pix-1; RAXLX"
                     /inference="alignment:Splign:2.1.0"
     regulatory      3336..3341
                     /regulatory_class="polyA_signal_sequence"
                     /gene="ISX"
                     /gene_synonym="Pix-1; RAXLX"
                     /note="hexamer: AATAAA"
     polyA_site      3362
                     /gene="ISX"
                     /gene_synonym="Pix-1; RAXLX"
                     /note="major polyA site"
ORIGIN      
agtcagagagaaagggcctcttcagtctgtctcaggagactgggagaaacagcataaaggaccccacaaggaagggagaggtaccctgggtcaggcgcttgtggagagagggcttcgcatgtaaagtgacgtcagggaaaatagaacagaaaaaaagccagggccagcccagaggcacctgagaagaatcagacccacagctcagcccagccctggcacagagaagagacaggcctggcagcacccagggaccccctttcctcagcctccacctgcaggacagcaggagcactgatgcgctgaaggtacgttctggagtctggaagcagcagaactgaaggaagtaaacacgggtgtctgggaagacccctcaagctgcagtaaagcccaggactgaattggccacctgaggccaagggtggcactccaacctcctcctaaaggctggctagagccacaggaaagggccagaagccagagaaagggcaaaggtggacccctgcctccaaacctcctctggagactgacctcctctttcctgtgccttattgtttctccctcttctctttgttcgccactgggcggtgacctcagggatcctggcctaacctggtgattgtgcaggcaactgtgtccgagaagacccttctctggaagattgaaccccaattcagccatggtgactcctttgatgtcaaactggtaagggctgagccgtgggcacaggataccactccttccagctcttctgctgtgacctgcccatggaagtccctgtggacacgaaatcctgtttggatcatctaactggaggctctctgttcttcacctccacgcgccctcttgaccccaggaggttcaggggaggaagtacgccactctccactggcaccctccttggcctacacagagtcacccctgagcccctcaatgtgtgctgaggtgggccctgctctctgcaggggtatggagagaaatagcttggggtgctgtgaggccccgaagaagctgagcctgtccttctccattgaggcgatcctaaagaggcctgccaggaggagtgatatggacagaccagaagggccaggtgaagagggccccggagaagctgcggcctcaggctctgggctagaaaagcctccaaaggaccagccccaggaaggaaggaagagcaagcggagggttcgtaccaccttcaccactgagcagctgcatgagctggagaagatcttccactttacccactacccagacgttcacatccgcagccagctggcagccaggatcaacctcccagaagctcgggtgcagatctggttccagaatcagcgagccaagtggcggaagcaggagaagattggcaacctgggggctccacagcagctgagtgaagccagtgtggccctgcccacaaatctggatgtggctgggcccacgtggacatccactgctctgcgcaggctggctcctcccacgagctgttgtccatcggctcaagatcagctggcctctgcctggttccctgcctggatcaccctcctcccagcgcacccatgggaaacacagcctgtcccaggtcttcccatccatcaaacttgcatccctgtgctatgcatccttccacctccacaccccaaatggggcagcatctgtgctacttcaacatagagattggacatgctctccccaaatgagccactttcctctccaggtgaaggcaggtagcagatgtgccctgggcctctggggaaatcgatttcacaatccaaaaatggcccacagcccaggaagctaccctgaacatgccagttggaaggctgcaccagactcaaaagcaaactaaacaataaaggacagctctcttctctcctggctaaagctgctctcctggttcagaagacaggctggatgagatctcaggccgagctctgaaatagggaggtaatcctccagcacctgtgtttcctctaacttgctgtgtgacctccagccggtcactcaccctctctggacctcatctgtaagaggagccagctggataagatgatttctgaagacgcttccatggtgggcactgaggcacagaggaggccaaggagaggttgtttgttcatgcatgcattcatccgtgacacatgagtacctactgaggactccataaacagaacgggatacagagataaacaatttgggttctgtccacgtttgtcaaaaggtggtgctggcccacctctgaaagcagaacacttgctcaacaaccttgctgttggcccaagtctaacacattctttatgactgtgagcatctcagagtgagagaaaaatgtagaaagttttttaaattctaaacaggatttagtgtctttagttatcttgctggatgggaaagggatgttgtcatttctggcacaaatgaaaagtaggacggaaagctcctttcattcagtttatctttccaggatatatgaaaagggaccagctggaagactagcctcactctgtcctcgaaagcctgagctttcattcaactccctatttccatgcaaagacgctgggcaaaccacatgttctgtctgagcctcagttttcctatccataaaatgaaggtagccaggcctgcctcaaagagcattcaggaggctctgagaggacatgagagtattttgcaaagtgagggcaaggcccagtgtggagtgatattgttattccaagattccactgcaaaagtggctgctttggatgccagcccaggatgagtagttcctgttctcagggaggtcatccgctgagcatcccttctgcacagatgtctctgattcttgtccttgcaggtggaggacagggcctgctcccctaagctgggaagcctggaatgacctcttgcacaagcctaaattccaggaatcttccccaaatcccagatcctctgcaatctacctgcacccctgacccacccaggagttggaccgggagttgggaagcctaggtcttagtcctacactccttctaatttgctgtgtaaccttaccattaatctctctgggtctcagttttctcatctgtattggaggtagcagtgctagctctgccttcaggcatgcaatatgccagaactacagacaacagcccacaggatgcaaaagtgctttgccatcttaaaaatgccagatcactcagagcctatgaatgtggatatcaacaccaggtctctagcaccgctggatgaaaggagaaggctagaggctgagggaggaaagagcagttaacaaacaaaggcagtagctcatcacttgggtagcaggtacccattttaggaccctacactcaaatgtgcaaaataaaatttctatcattttgctataa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]