2024-05-04 00:22:32, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001410927 2229 bp mRNA linear PRI 01-JAN-2023 DEFINITION Homo sapiens LIM homeobox 9 (LHX9), transcript variant 4, mRNA. ACCESSION NM_001410927 XM_005245350 VERSION NM_001410927.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2229) AUTHORS Okutomo K, Fujino N, Yamada M, Saito T, Ono Y, Okada Y, Ichinose M and Sugiura H. TITLE Increased LHX9 expression in alveolar epithelial type 2 cells of patients with chronic obstructive pulmonary disease JOURNAL Respir Investig 60 (1), 119-128 (2022) PUBMED 34548271 REMARK GeneRIF: Increased LHX9 expression in alveolar epithelial type 2 cells of patients with chronic obstructive pulmonary disease. REFERENCE 2 (bases 1 to 2229) AUTHORS Luo X, Ge J, Chen T, Liu J, Liu Z, Bi C and Lan S. TITLE LHX9, a p53-binding protein, inhibits the progression of glioma by suppressing glycolysis JOURNAL Aging (Albany NY) 13 (18), 22109-22119 (2021) PUBMED 34536269 REMARK GeneRIF: LHX9, a p53-binding protein, inhibits the progression of glioma by suppressing glycolysis. REFERENCE 3 (bases 1 to 2229) AUTHORS Luck K, Kim DK, Lambourne L, Spirohn K, Begg BE, Bian W, Brignall R, Cafarelli T, Campos-Laborie FJ, Charloteaux B, Choi D, Cote AG, Daley M, Deimling S, Desbuleux A, Dricot A, Gebbia M, Hardy MF, Kishore N, Knapp JJ, Kovacs IA, Lemmens I, Mee MW, Mellor JC, Pollis C, Pons C, Richardson AD, Schlabach S, Teeking B, Yadav A, Babor M, Balcha D, Basha O, Bowman-Colin C, Chin SF, Choi SG, Colabella C, Coppin G, D'Amata C, De Ridder D, De Rouck S, Duran-Frigola M, Ennajdaoui H, Goebels F, Goehring L, Gopal A, Haddad G, Hatchi E, Helmy M, Jacob Y, Kassa Y, Landini S, Li R, van Lieshout N, MacWilliams A, Markey D, Paulson JN, Rangarajan S, Rasla J, Rayhan A, Rolland T, San-Miguel A, Shen Y, Sheykhkarimli D, Sheynkman GM, Simonovsky E, Tasan M, Tejeda A, Tropepe V, Twizere JC, Wang Y, Weatheritt RJ, Weile J, Xia Y, Yang X, Yeger-Lotem E, Zhong Q, Aloy P, Bader GD, De Las Rivas J, Gaudet S, Hao T, Rak J, Tavernier J, Hill DE, Vidal M, Roth FP and Calderwood MA. TITLE A reference map of the human binary protein interactome JOURNAL Nature 580 (7803), 402-408 (2020) PUBMED 32296183 REFERENCE 4 (bases 1 to 2229) AUTHORS Hu F, Zhu Q, Sun B, Cui C, Li C and Zhang L. TITLE Smad ubiquitylation regulatory factor 1 promotes LIM-homeobox gene 9 degradation and represses testosterone production in Leydig cells JOURNAL FASEB J 32 (9), 4627-4640 (2018) PUBMED 29565736 REMARK GeneRIF: that Smurf1 promotes Lhx9 ubiquitylation and is involved in testosterone production in Leydig cells directly REFERENCE 5 (bases 1 to 2229) AUTHORS Yin Y, Morgunova E, Jolma A, Kaasinen E, Sahu B, Khund-Sayeed S, Das PK, Kivioja T, Dave K, Zhong F, Nitta KR, Taipale M, Popov A, Ginno PA, Domcke S, Yan J, Schubeler D, Vinson C and Taipale J. TITLE Impact of cytosine methylation on DNA binding specificities of human transcription factors JOURNAL Science 356 (6337) (2017) PUBMED 28473536 REFERENCE 6 (bases 1 to 2229) AUTHORS Vaquerizas JM, Kummerfeld SK, Teichmann SA and Luscombe NM. TITLE A census of human transcription factors: function, expression and evolution JOURNAL Nat Rev Genet 10 (4), 252-263 (2009) PUBMED 19274049 REMARK Review article REFERENCE 7 (bases 1 to 2229) AUTHORS Barrios-Rodiles M, Brown KR, Ozdamar B, Bose R, Liu Z, Donovan RS, Shinjo F, Liu Y, Dembowy J, Taylor IW, Luga V, Przulj N, Robinson M, Suzuki H, Hayashizaki Y, Jurisica I and Wrana JL. TITLE High-throughput mapping of a dynamic signaling network in mammalian cells JOURNAL Science 307 (5715), 1621-1625 (2005) PUBMED 15761153 REFERENCE 8 (bases 1 to 2229) AUTHORS Ottolenghi C, Moreira-Filho C, Mendonca BB, Barbieri M, Fellous M, Berkovitz GD and McElreavey K. TITLE Absence of mutations involving the LIM homeobox domain gene LHX9 in 46,XY gonadal agenesis and dysgenesis JOURNAL J Clin Endocrinol Metab 86 (6), 2465-2469 (2001) PUBMED 11397841 REFERENCE 9 (bases 1 to 2229) AUTHORS Retaux S, Rogard M, Bach I, Failli V and Besson MJ. TITLE Lhx9: a novel LIM-homeodomain gene expressed in the developing forebrain JOURNAL J Neurosci 19 (2), 783-793 (1999) PUBMED 9880598 REFERENCE 10 (bases 1 to 2229) AUTHORS Adams MD, Kerlavage AR, Fleischmann RD, Fuldner RA, Bult CJ, Lee NH, Kirkness EF, Weinstock KG, Gocayne JD, White O et al. TITLE Initial assessment of human gene diversity and expression patterns based upon 83 million nucleotides of cDNA sequence JOURNAL Nature 377 (6547 Suppl), 3-174 (1995) PUBMED 7566098 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL590115.7. On Aug 18, 2022 this sequence version replaced XM_005245350.4. Summary: This gene encodes a member of the LIM homeobox gene family of developmentally expressed transcription factors. The encoded protein contains a homeodomain and two cysteine-rich zinc-binding LIM domains involved in protein-protein interactions. The protein is highly similar to a mouse protein that causes gonadal agenesis when inactivated, suggesting a role in gonadal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: SRR14038193.2420349.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2148093, SAMEA2148874 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-678 AL590115.7 136875-137552 679-797 AL590115.7 138680-138798 798-1000 AL590115.7 140773-140975 1001-1356 AL590115.7 142105-142460 1357-1559 AL590115.7 148392-148594 1560-2229 AL590115.7 152720-153389 FEATURES Location/Qualifiers source 1..2229 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="1" /map="1q31.3" gene 1..2229 /gene="LHX9" /note="LIM homeobox 9" /db_xref="GeneID:56956" /db_xref="HGNC:HGNC:14222" /db_xref="MIM:606066" exon 1..678 /gene="LHX9" /inference="alignment:Splign:2.1.0" misc_feature 600..602 /gene="LHX9" /note="upstream in-frame stop codon" CDS 606..1616 /gene="LHX9" /note="isoform 4 is encoded by transcript variant 4; LIM/homeobox protein Lhx9; LIM homeobox protein 9" /codon_start=1 /product="LIM/homeobox protein Lhx9 isoform 4" /protein_id="NP_001397856.1" /db_xref="CCDS:CCDS91139.1" /db_xref="GeneID:56956" /db_xref="HGNC:HGNC:14222" /db_xref="MIM:606066" /translation="
MQTLQTPSPLRMKPASSRVSGPQEAMLFHGISGGHIQGIMEEMERRSKTEARLAKGAQLNGRDAGMPPLSPEKPALCAGCGGKISDRYYLLAVDKQWHLRCLKCCECKLALESELTCFAKDGSIYCKEDYYRRFSVQRCARCHLGISASEMVMRARDSVYHLSCFTCSTCNKTLTTGDHFGMKDSLVYCRAHFETLLQGEYPPQLSYTELAAKSGGLALPYFNGTGTVQKGRPRKRKSPALGVDIVNYNSGCNENEADHLDRDQQPYPPSQKTKRMRTSFKHHQLRTMKSYFAINHNPDAKDLKQLAQKTGLTKRVLQGEQILGHYSQTSRRLKIP"
misc_feature 804..995 /gene="LHX9" /note="The first LIM domain of Lhx2; Region: LIM1_Lhx2; cd09469" /db_xref="CDD:188853" misc_feature order(834..836,843..845,897..899,906..908,915..917, 924..926,981..983,990..992) /gene="LHX9" /note="Zn binding site [ion binding]; other site" /db_xref="CDD:188853" misc_feature 1008..1184 /gene="LHX9" /note="The second LIM domain of Lhx2 and Lhx9 family; Region: LIM2_Lhx2_Lhx9; cd09377" /db_xref="CDD:188763" misc_feature order(1020..1022,1029..1031,1086..1088,1095..1097, 1104..1106,1113..1115,1170..1172,1179..1181) /gene="LHX9" /note="Zn binding site [ion binding]; other site" /db_xref="CDD:188763" misc_feature 1422..>1559 /gene="LHX9" /note="Homeodomain; Region: HOX; smart00389" /db_xref="CDD:197696" exon 679..797 /gene="LHX9" /inference="alignment:Splign:2.1.0" exon 798..1000 /gene="LHX9" /inference="alignment:Splign:2.1.0" exon 1001..1356 /gene="LHX9" /inference="alignment:Splign:2.1.0" exon 1357..1559 /gene="LHX9" /inference="alignment:Splign:2.1.0" exon 1560..2229 /gene="LHX9" /inference="alignment:Splign:2.1.0" regulatory 1945..1950 /regulatory_class="polyA_signal_sequence" /gene="LHX9" /note="hexamer: AATAAA" polyA_site 1969 /gene="LHX9" regulatory 2207..2212 /regulatory_class="polyA_signal_sequence" /gene="LHX9" /note="hexamer: AATAAA" polyA_site 2229 /gene="LHX9" /note="major polyA site" ORIGIN
ggaaggaacagagagcggccggcgcgtcctcctctctgggtaaagccgcgttggttcctgccgcagcgctgtgcttcggactcctagggggcctctggccgtttgaatgaatcgacaatatcagagtattgtggacactttttaatggggccggggaggggccgccgctgccgagaactgagggcgacagaacaatcccacctcttgtgaggagcaggtctgccattctgcttgtcagttctcaccttcccctcctccacggcaaagagtccctttcacacccttctgagtgtgcgggtgcgcccagttttacaagtcctctgtcctgccagggtagtgggagaagcacgcgatggggctagcgcccagtcctgcgggggcaggcgccaagctcccgggagtccgcaagtcgcttcctatattggcaagcttcaaatgagacattagaatctccggcaaccttccttcaaacctgaaccggggaagagaataagccgccctatggccaaggcgcaattgcgtacccgtgtgtacaggtccatgccctgtcccctacactctaattttctcaaagaaaattgttttgccaaaagtaaccctgagaaatgcagacgctccaaacgccctctccacttcggatgaagccagcatctagtagggtctccggccctcaagaagccatgctctttcacgggatctccggaggccacatccaaggcatcatggaggagatggagcgcagatccaagactgaggcccgtctggccaaaggcgcccagctcaacggccgcgacgcgggcatgcccccgctcagcccggagaagcccgccctgtgcgccggctgcgggggcaagatctcggacaggtactatctgctggctgtggacaaacagtggcatctgagatgcctgaagtgctgtgaatgtaagctggccctcgagtccgagctcacctgctttgccaaggacggtagcatttactgcaaggaggattactacagaaggttctctgtgcagagatgtgcccgctgccaccttggcatttccgcctcggagatggtcatgcgcgcccgagactctgtctaccacctgagctgcttcacctgctccacttgcaacaagactctgaccacgggcgaccatttcggcatgaaggacagcctggtgtactgccgcgcccacttcgagaccctcttgcaaggagagtatccaccgcagctgagctacacggagctggcggccaagagcggcggcctggccctgccttacttcaacggtacgggcaccgtgcagaaagggcggccccggaagcggaagagcccagcgctgggagtggacatcgtcaattacaactcaggttgtaatgagaatgaggcagaccacttggaccgggaccagcagccttatccaccctcgcagaagaccaagcgcatgcgaacctctttcaagcatcaccagctccggaccatgaaatcctactttgccatcaaccacaacccggatgccaaggacctcaagcagcttgcccagaaaacaggtctgaccaaaagagttttgcagggagaacaaatcttggggcattacagccaaacatcccgacgtttgaaaattccctaaagtattaaaagaaggggaaaagtttgatcggaaatccactgcagtgaagacaaagacactattaggttatgataatcatacattaaaaaatttattaagccaaaaaaaaagagagagagagagacttaaatgtcatttactgaatgttaacgaaacttgtgttctttatggtgtctaacacaactgaaggcctaaaattatgtggtttaaacaaaattagataaaccatgtacaaaaccagagcaacctggcagtaatatgcccaccccatatttgaaaaaaattattattgaaaaaaatttcacacatttgtcaagcacagttgtaaaataaagtccaaaacattcatttcacctgcttgctaatgtgtattagtcctgttaatggcattttccaactgtaaattcaaagaaaagctatcacccatttaagagtatagggatcaaaccccagtaattttagcattattgtttatcacttcctttttaaacagaaatctctgcatgcacttttacatatgtcacctctagtgtacacctctgtatgatgacttatctttgctgtttcttgtatgataaatagctttcattaataaacatttatttgatgcaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]