2025-07-16 03:05:49, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001406532 6823 bp mRNA linear PRI 15-OCT-2024 DEFINITION Homo sapiens ATPase copper transporting beta (ATP7B), transcript variant 26, mRNA. ACCESSION NM_001406532 VERSION NM_001406532.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 6823) AUTHORS Zhang,K., Qu,C., Zhou,P., Yang,Z. and Wu,X. TITLE Integrative analysis of the cuproptosis-related gene ATP7B in the prognosis and immune infiltration of IDH1 wild-type glioma JOURNAL Gene 905, 148220 (2024) PUBMED 38286269 REMARK GeneRIF: Integrative analysis of the cuproptosis-related gene ATP7B in the prognosis and immune infiltration of IDH1 wild-type glioma. REFERENCE 2 (bases 1 to 6823) AUTHORS Ruturaj, Mishra,M., Saha,S., Maji,S., Rodriguez-Boulan,E., Schreiner,R. and Gupta,A. TITLE Regulation of the apico-basolateral trafficking polarity of the homologous copper-ATPases ATP7A and ATP7B JOURNAL J Cell Sci 137 (5) (2024) PUBMED 38032054 REMARK GeneRIF: Regulation of the apico-basolateral trafficking polarity of the homologous copper-ATPases ATP7A and ATP7B. REFERENCE 3 (bases 1 to 6823) AUTHORS Tavares,L.A., Rodrigues,R.L., Santos da Costa,C., Nascimento,J.A., Vargas de Carvalho,J., Nogueira de Carvalho,A., Mardones,G.A. and daSilva,L.L.P. TITLE AP-1gamma2 is an adaptor protein 1 variant required for endosome-to-Golgi trafficking of the mannose-6-P receptor (CI-MPR) and ATP7B copper transporter JOURNAL J Biol Chem 300 (3), 105700 (2024) PUBMED 38307383 REMARK GeneRIF: AP-1gamma2 is an adaptor protein 1 variant required for endosome-to-Golgi trafficking of the mannose-6-P receptor (CI-MPR) and ATP7B copper transporter. REFERENCE 4 (bases 1 to 6823) AUTHORS Gorukmez,O., Ozgur,T., Gorukmez,O. and Topak,A. TITLE ATP7B Gene Variant Profile Identified by NGS in Wilson's Disease JOURNAL Fetal Pediatr Pathol 42 (6), 891-900 (2023) PUBMED 37737146 REMARK GeneRIF: ATP7B Gene Variant Profile Identified by NGS in Wilson's Disease. REFERENCE 5 (bases 1 to 6823) AUTHORS Petrukhin,K., Lutsenko,S., Chernov,I., Ross,B.M., Kaplan,J.H. and Gilliam,T.C. TITLE Characterization of the Wilson disease gene encoding a P-type copper transporting ATPase: genomic organization, alternative splicing, and structure/function predictions JOURNAL Hum Mol Genet 3 (9), 1647-1656 (1994) PUBMED 7833924 REFERENCE 6 (bases 1 to 6823) AUTHORS Petrukhin,K., Fischer,S.G., Pirastu,M., Tanzi,R.E., Chernov,I., Devoto,M., Brzustowicz,L.M., Cayanis,E., Vitale,E., Russo,J.J. et al. TITLE Mapping, cloning and genetic characterization of the region containing the Wilson disease gene JOURNAL Nat Genet 5 (4), 338-343 (1993) PUBMED 8298640 REFERENCE 7 (bases 1 to 6823) AUTHORS Bull,P.C., Thomas,G.R., Rommens,J.M., Forbes,J.R. and Cox,D.W. TITLE The Wilson disease gene is a putative copper transporting P-type ATPase similar to the Menkes gene JOURNAL Nat Genet 5 (4), 327-337 (1993) PUBMED 8298639 REMARK Erratum:[Nat Genet 1994 Feb;6(2):214] REFERENCE 8 (bases 1 to 6823) AUTHORS Yamaguchi,Y., Heiny,M.E. and Gitlin,J.D. TITLE Isolation and characterization of a human liver cDNA as a candidate gene for Wilson disease JOURNAL Biochem Biophys Res Commun 197 (1), 271-277 (1993) PUBMED 8250934 REFERENCE 9 (bases 1 to 6823) AUTHORS Weiss,K.H. and Schilsky,M. TITLE Wilson Disease JOURNAL (in) Adam MP, Feldman J, Mirzaa GM, Pagon RA, Wallace SE and Amemiya A (Eds.); GENEREVIEWS(R); (1993) PUBMED 20301685 REFERENCE 10 (bases 1 to 6823) AUTHORS Klein,C., Lohmann,K., Marras,C. and Munchau,A. TITLE Hereditary Dystonia Overview JOURNAL (in) Adam MP, Feldman J, Mirzaa GM, Pagon RA, Wallace SE and Amemiya A (Eds.); GENEREVIEWS(R); (1993) PUBMED 20301334 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL139082.18, AL138821.12 and AL162377.10. Summary: This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein is a monomer, and functions as a copper-transporting ATPase which exports copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease which is characterized by copper accumulation. [provided by RefSeq, Dec 2019]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: SRR14038193.3052847.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMEA1965299, SAMEA1966682 [ECO:0006172] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-352 AL139082.18 30120-30471 c 353-641 AL139082.18 29750-30038 c 642-1875 AL138821.12 33967-35200 c 1876-2133 AL138821.12 30524-30781 c 2134-2297 AL138821.12 28476-28639 c 2298-2459 AL138821.12 24904-25065 c 2460-2693 AL138821.12 18343-18576 c 2694-2785 AL138821.12 17548-17639 c 2786-2913 AL138821.12 10304-10431 c 2914-3068 AL138821.12 10039-10193 c 3069-3203 AL138821.12 9694-9828 c 3204-3398 AL138821.12 6316-6510 c 3399-3581 AL138821.12 4141-4323 c 3582-3750 AL138821.12 2418-2586 c 3751-3894 AL138821.12 1113-1256 c 3895-4037 AL162377.10 168087-168229 c 4038-4241 AL162377.10 166512-166715 c 4242-4359 AL162377.10 166312-166429 c 4360-4462 AL162377.10 164629-164731 c 4463-6823 AL162377.10 161705-164065 c FEATURES Location/Qualifiers source 1..6823 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="13" /map="13q14.3" gene 1..6823 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="ATPase copper transporting beta" /db_xref="GeneID:540" /db_xref="HGNC:HGNC:870" /db_xref="MIM:606882" exon 1..352 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 353..641 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" misc_feature 423..425 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="upstream in-frame stop codon" CDS 591..4736 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /EC_number="7.2.2.8" /note="isoform e is encoded by transcript variant 26; copper-transporting ATPase 2; copper pump 2; ATPase, Cu++ transporting, beta polypeptide; Wilson disease-associated protein; ATPase, Cu(2+)- transporting, beta polypeptide; copper-transporting protein ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform e" /protein_id="NP_001393461.1" /db_xref="GeneID:540" /db_xref="HGNC:HGNC:870" /db_xref="MIM:606882" /translation="
MPEQERQITAREGASRKILSKLSLPTRAWEPAMKKSFAFDNVGYEGGLDGLGPSSQVATSTVRILGMTCQSCVKSIEDRISNLKGIISMKVSLEQGSATVKYVPSVVCLQQVCHQIGDMGFEASIAEGKAASWPSRSLPAQEAVVKLRVEGMTCQSCVSSIEGKVRKLQGVVRVKVSLSNQEAVITYQPYLIQPEDLRDHVNDMGFEAAIKSKVAPLSLGPIDIERLQSTNPKRPLSSANQNFNNSETLGHQGSHVVTLQLRIDGMHCKSCVLNIEENIGQLLGVQSIQVSLENKTAQVKYDPSCTSPVALQRAIEALPPGNFKVSLPDGAEGSGTDHRSSSSHSPGSPPRNQVQGTCSTTLIAIAGMTCASCVHSIEGMISQLEGVQQISVSLAEGTATVLYNPSVISPEELRAAIEDMGFEASVVSESCSTNPLGNHSAGNSMVQTTDGTPTSVQEVAPHTGRLPANHAPDILAKSPQSTRAVAPQKCFLQIKGMTCASCVSNIERNLQKEAGVLSVLVALMAGKAEIKYDPEVIQPLEIAQFIQDLGFEAAVMEDYAGSDGNIELTITGMTCASCVHNIESKLTRTNGITYASVALATSKALVKFDPEIIGPRDIIKIIELLGGWYFYVQAYKSLRHRSANMDVLIVLATSIAYVYSLVILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHLAKSKTSEALAKLMSLQATEATVVTLGEDNLIIREEQVPMELVQRGDIVKVVPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLIKATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIMSTLTLVVWIVIGFIDFGVVQRYFPNPNKHISQTEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPRVMRVLLLGDVATLPLRKVLAVVGTAEASSEHPLGVAVTKYCKEELGTETLGYCTDFQAVPGCGIGCKVSNVEGILAHSERPLSAPASHLNEAGSLPAEKDAVPQTFSVLIGNREWLRRNGLTISSDVSDAMTDHEMKGQTAILVAIDGVLCGMIAIADAVKQEAALAVHTLQSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNKGKKVAMVGDGVNDSPALAQADMGVAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLVLALIYNLVGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYEAQAHGHMKPLTASQVSVHIGMDDRWRDSPRATPWDQVSYVSQVSLSSLTSDKPSRHSAAADDDGDKWSLLLNGRDEEQYI"
misc_feature 771..962 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(789..797,804..806) /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1026..1217 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1044..1052,1059..1061) /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1368..1544 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1386..1394,1401..1403) /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1677..1865 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1692..1700,1707..1709) /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2064..2252 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(2079..2087,2094..2096) /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2289..2468 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(2307..2315,2322..2324) /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2451..4400 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(3285..3287,3291..3293,4329..4331) /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3417..3425,3627..3629,3780..3788,3876..3878, 3996..4004,4062..4064,4071..4073,4080..4082,4137..4139, 4146..4148) /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" exon 642..1875 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 1876..2133 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 2134..2297 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 2298..2459 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 2460..2693 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 2694..2785 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 2786..2913 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 2914..3068 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 3069..3203 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 3204..3398 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 3399..3581 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 3582..3750 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 3751..3894 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 3895..4037 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 4038..4241 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 4242..4359 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 4360..4462 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" exon 4463..6823 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /inference="alignment:Splign:2.1.0" regulatory 6796..6801 /regulatory_class="polyA_signal_sequence" /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="hexamer: AATAAA" polyA_site 6823 /gene="ATP7B" /gene_synonym="PWD; WC1; WD; WND" /note="major polyA site" ORIGIN
actcttgccgcggttgcttcctttgggacccacggcgtccggcagccaggcgcagagtccgaggagggggcagcgcagagcggacccgacgcggcgccgccgggcaccttccccgcaggcggtgggtgagccctgggagctgagtctgcggcccggctctgcgcagctcacctgccctcccgctcccgcacacgcgtgagatcccagtacagtgtcggagcgcaccagcgcgaggtggccgagaccgcggaggaggacaggcctccgccctgcggcgccggcacggcagaggacattgtggcactggcacggcagagaacactgtggcaccggcggggccggcagttccagggtcgggaggacggcggcgcgcaactttgaatcatccgtgtgaagagggctgcggcttccccggtcccaaatgaaggggcggttcccggacccctgtttgctttagagccgagccgcgccgatgccctcacactctgcgcctcctctcccgggactttaacaccccgctctcctccaccgaccaggtgaccttttgctctgagccagatcagagaagaattcggtgtccgtgcgggacgatgcctgagcaggagagacagatcacagccagagaaggggccagtcggaaaatcttatctaagctttctttgcctacccgtgcctgggaaccagcaatgaagaagagttttgcttttgacaatgttggctatgaaggtggtctggatggcctgggcccttcttctcaggtggccaccagcacagtcaggatcttgggcatgacttgccagtcatgtgtgaagtccattgaggacaggatttccaatttgaaaggcatcatcagcatgaaggtttccctggaacaaggcagtgccactgtgaaatatgtgccatcggttgtgtgcctgcaacaggtttgccatcaaattggggacatgggcttcgaggccagcattgcagaaggaaaggcagcctcctggccctcaaggtccttgcctgcccaggaggctgtggtcaagctccgggtggagggcatgacctgccagtcctgtgtcagctccattgaaggcaaggtccggaaactgcaaggagtagtgagagtcaaagtctcactcagcaaccaagaggccgtcatcacttatcagccttatctcattcagcccgaagacctcagggaccatgtaaatgacatgggatttgaagctgccatcaagagcaaagtggctcccttaagcctgggaccaattgatattgagcggttacaaagcactaacccaaagagacctttatcttctgctaaccagaattttaataattctgagaccttggggcaccaaggaagccatgtggtcaccctccaactgagaatagatggaatgcattgtaagtcttgcgtcttgaatattgaagaaaatattggccagctcctaggggttcaaagtattcaagtgtccttggagaacaaaactgcccaagtaaagtatgacccttcttgtaccagcccagtggctctgcagagggctatcgaggcacttccacctgggaattttaaagtttctcttcctgatggagccgaagggagtgggacagatcacaggtcttccagttctcattcccctggctccccaccgagaaaccaggtccagggcacatgcagtaccactctgattgccattgccggcatgacctgtgcatcctgtgtccattccattgaaggcatgatctcccaactggaaggggtgcagcaaatatcggtgtctttggccgaagggactgcaacagttctttataatccctctgtaattagcccagaagaactcagagctgctatagaagacatgggatttgaggcttcagtcgtttctgaaagctgttctactaaccctcttggaaaccacagtgctgggaattccatggtgcaaactacagatggtacacctacatctgtgcaggaagtggctccccacactgggaggctccctgcaaaccatgccccggacatcttggcaaagtccccacaatcaaccagagcagtggcaccgcagaagtgcttcttacagatcaaaggcatgacctgtgcatcctgtgtgtctaacatagaaaggaatctgcagaaagaagctggtgttctctccgtgttggttgccttgatggcaggaaaggcagagatcaagtatgacccagaggtcatccagcccctcgagatagctcagttcatccaggacctgggttttgaggcagcagtcatggaggactacgcaggctccgatggcaacattgagctgacaatcacagggatgacctgcgcgtcctgtgtccacaacatagagtccaaactcacgaggacaaatggcatcacttatgcctccgttgcccttgccaccagcaaagcccttgttaagtttgacccggaaattatcggtccacgggatattatcaaaattattgagctcctcggtgggtggtacttctacgttcaggcctacaaatctctgagacacaggtcagccaacatggacgtgctcatcgtcctggccacaagcattgcttatgtttattctctggtcatcctggtggttgctgtggctgagaaggcggagaggagccctgtgacattcttcgacacgccccccatgctctttgtgttcattgccctgggccggtggctggaacacttggcaaagagcaaaacctcagaagccctggctaaactcatgtctctccaagccacagaagccaccgttgtgacccttggtgaggacaatttaatcatcagggaggagcaagtccccatggagctggtgcagcggggcgatatcgtcaaggtggtccctgggggaaagtttccagtggatgggaaagtcctggaaggcaataccatggctgatgagtccctcatcacaggagaagccatgccagtcactaagaaacccggaagcactgtaattgcggggtctataaatgcacatggctctgtgctcattaaagctacccacgtgggcaatgacaccactttggctcagattgtgaaactggtggaagaggctcagatgtcaaaggcacccattcagcagctggctgaccggtttagtggatattttgtcccatttatcatcatcatgtcaactttgacgttggtggtatggattgtaatcggttttatcgattttggtgttgttcagagatactttcctaaccccaacaagcacatctcccagacagaggtgatcatccggtttgctttccagacgtccatcacggtgctgtgcattgcctgcccctgctccctggggctggccacgcccacggctgtcatggtgggcaccggggtggccgcgcagaacggcatcctcatcaagggaggcaagcccctggagatggcgcacaagataaagactgtgatgtttgacaagactggcaccattacccatggcgtccccagggtcatgcgggtgctcctgctgggggatgtggccacactgcccctcaggaaggttctggctgtggtggggactgcggaggccagcagtgaacaccccttgggcgtggcagtcaccaaatactgtaaagaggaacttggaacagagaccttgggatactgcacggacttccaggcagtgccaggctgtggaattgggtgcaaagtcagcaacgtggaaggcatcctggcccacagtgagcgccctttgagtgcaccggccagtcacctgaatgaggctggcagccttcccgcagaaaaagatgcagtcccccagaccttctctgtgctgattggaaaccgtgagtggctgaggcgcaacggtttaaccatttctagcgatgtcagtgacgctatgacagaccacgagatgaaaggacagacagccatcctggtggctattgacggtgtgctctgtgggatgatcgcaatcgcagacgctgtcaagcaggaggctgccctggctgtgcacacgctgcagagcatgggtgtggacgtggttctgatcacgggggacaaccggaagacagccagagctattgccacccaggttggcatcaacaaagtctttgcagaggtgctgccttcgcacaaggtggccaaggtccaggagctccagaataaagggaagaaagtcgccatggtgggggatggggtcaatgactccccggccttggcccaggcagacatgggtgtggccattggcaccggcacggatgtggccatcgaggcagccgacgtcgtccttatcagaaatgatttgctggatgtggtggctagcattcacctttccaagaggactgtccgaaggatacgcatcaacctggtcctggcactgatttataacctggttgggatacccattgcagcaggtgtcttcatgcccatcggcattgtgctgcagccctggatgggctcagcggccatggcagcctcctctgtgtctgtggtgctctcatccctgcagctcaagtgctataagaagcctgacctggagaggtatgaggcacaggcgcatggccacatgaagcccctgacggcatcccaggtcagtgtgcacataggcatggatgacaggtggcgggactcccccagggccacaccatgggaccaggtcagctatgtcagccaggtgtcgctgtcctccctgacgtccgacaagccatctcggcacagcgctgcagcagacgatgatggggacaagtggtctctgctcctgaatggcagggatgaggagcagtacatctgatgacttcaggcaggcgggccggggcagggacttgcctccactcaccacaagctgagcaggacagccagcagcaggatgggctgagctagcctccagctttggggacttccgctccctggatatgtccagtcatcctgccctgcagcacgcggccttgtctgggtgcagctgggcttggcctggagaggacggccctgcctgcctcttggcctcacgggaccgtcagcatgggctttgtcttggactctagtccttggctggactgtagaaggtgagaggcgagtcaccctcctcacagacctctgcttggagtatttaggatgactgctgtgaaatggagaacagtttcatcaggaccaaaaaacctcactgggcctttccagagaactgcagacctcactgtcagggtctttctgatgacgcctgtctgtgtgcatcatgtttctgagaccacagtttacctcaggtgtgcctgttgctttcttcctgcatagtctgttcctttcttcgtacatagtctgttccttttctctcctgtgtgcttgtcagtggggacccctcgcaaccctgcctgtcacctgggagggtgggaccaatgtccttgtggtctttgctgctgctctcaggcgcttctccaatgctctggagtgtgcatttcagcttgaacctgcttcctggctcacacatccccagccagggagcttgccacactcttcttcaagttgaggagagttcttttttgcttaaagcccccttctccatggagtgttggcttctcaatagagtgttgttgctgaccagctggagtgagggcctcagagcctgacctgagagtccgtactcggcttcctgtggggtgtaggttctcgcgattcaggacgtccttccatatccctgcccagcctgtggtgcttgaaacgtttgccccatgggaaacgtatgtgtgcaggagcctccctgcacggcccaaggggcttcgttttcagtcttctgactgtcacctcgtggggttcagtagagaattcatgtgactagcgcctggccttgtgtggcttggaggaaatggtactgcccaaataggaggaaaacacagcctccctgagcctgcattctgcacgctgcccaggggcttcagaaaaggagtggccacagcaccccgaagggagcatctgtttacctggcagtggctctcagagcagcagaacgggttcagttttagactctgaagttggttgtgattgacagaaccctttgggagcaaactagtagagttggattaaattctgggtgaaacccttttctcccacacaaaatagttttagtgatttttttcattgtccattacttgccaggggcagttttagcagcacttttgatagattacgtctaatcctcccaaccaaccagcagggtagctattactgtccacattttacaggcaaggaaacaggctccaagaggctgaggactttgcccaggatgacatagccaatggacaagcagtgtctgtcagctgtgaaggcttcactcttattgtccttctaccttgaatagaagttttcctgataagaataaacgaggaaaaggtccttgcctcctggaagaacaaatctaccaggtgatctattcattgtttcaactcagaatgcacttgattcaggaggtcatctgaccttcaccttggatggttagtttcactttttacatatagtttttgcagggttttattttataaaatccaagcgcgctgttgattgtgttttccttgttttcagcccccccactccagcccgcagcacatttccgctgtccgtcagtaattgtgtcctctctttatgcttgcttggggaatgttgttttctgactaggctgatcattatctaaagaatctaattctgttgatttttaaaacttttaggaccataaacgttgtgttcatatatggacatggaaatatttatataattttatagaaaataaccttttagatggtcaaagtgtaaggagtttttttgtcagataatcatttctacttcaaaaacatttcatgcaatattagaataaagttcctgtcattcctctaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]